ID: 1035192777

View in Genome Browser
Species Human (GRCh38)
Location 7:157186741-157186763
Sequence TACGAAATCACATTTTTCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 263}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035192777_1035192779 21 Left 1035192777 7:157186741-157186763 CCGAAGAAAAATGTGATTTCGTA 0: 1
1: 0
2: 0
3: 25
4: 263
Right 1035192779 7:157186785-157186807 GTTCCAGTTGAGCACATTTATGG 0: 1
1: 0
2: 1
3: 7
4: 91
1035192777_1035192781 28 Left 1035192777 7:157186741-157186763 CCGAAGAAAAATGTGATTTCGTA 0: 1
1: 0
2: 0
3: 25
4: 263
Right 1035192781 7:157186792-157186814 TTGAGCACATTTATGGAGACTGG 0: 1
1: 0
2: 0
3: 11
4: 255
1035192777_1035192778 -4 Left 1035192777 7:157186741-157186763 CCGAAGAAAAATGTGATTTCGTA 0: 1
1: 0
2: 0
3: 25
4: 263
Right 1035192778 7:157186760-157186782 CGTATATGTTTGTAGTGTAGAGG 0: 1
1: 0
2: 0
3: 4
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035192777 Original CRISPR TACGAAATCACATTTTTCTT CGG (reversed) Intronic