ID: 1035192779

View in Genome Browser
Species Human (GRCh38)
Location 7:157186785-157186807
Sequence GTTCCAGTTGAGCACATTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035192776_1035192779 22 Left 1035192776 7:157186740-157186762 CCCGAAGAAAAATGTGATTTCGT 0: 1
1: 0
2: 3
3: 26
4: 305
Right 1035192779 7:157186785-157186807 GTTCCAGTTGAGCACATTTATGG 0: 1
1: 0
2: 1
3: 7
4: 91
1035192777_1035192779 21 Left 1035192777 7:157186741-157186763 CCGAAGAAAAATGTGATTTCGTA 0: 1
1: 0
2: 0
3: 25
4: 263
Right 1035192779 7:157186785-157186807 GTTCCAGTTGAGCACATTTATGG 0: 1
1: 0
2: 1
3: 7
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035192779 Original CRISPR GTTCCAGTTGAGCACATTTA TGG Intronic
902060605 1:13638976-13638998 GTTCAAGTTAAGCAAGTTTATGG + Intergenic
915843088 1:159232688-159232710 TTTCCAGTTGTGGACATTGATGG - Intergenic
916886873 1:169078105-169078127 GTTCCAGTTGAAAACAATTAAGG + Intergenic
917786204 1:178460394-178460416 GTTCCAGATGAGCACAAAAAAGG - Intronic
921666664 1:217880968-217880990 TTTCCAGTTGAGCAACTCTAAGG - Intergenic
921852585 1:219946935-219946957 GAGCCAGTTGAGCACATTGTTGG - Intronic
923365185 1:233253072-233253094 TTTCCAGCTGGGCACATGTATGG - Intronic
1068927020 10:62551063-62551085 CTTCCAGCTGGGCACATTTCAGG + Intronic
1069422712 10:68261205-68261227 GCTCCAGATGAGCAAATTCAAGG + Intergenic
1077758911 11:5068941-5068963 GTTCCAGTTGTATACATTTGTGG + Intergenic
1084379346 11:68801193-68801215 GTTCCACTTCAGCTCATTCAGGG - Intronic
1088178221 11:107078686-107078708 GCTCCAGTTAAGCAGATTTTGGG + Intergenic
1093145507 12:15561179-15561201 TTTCAAGTTGTCCACATTTATGG - Intronic
1093428413 12:19055314-19055336 GTTTCTGTTGATCACAATTAGGG + Intergenic
1099093475 12:78342227-78342249 TTTCCAGTTAAGCACATACAAGG + Intergenic
1099518353 12:83627495-83627517 GTTTAAGTTAAGCACGTTTACGG + Intergenic
1100044623 12:90364520-90364542 GTTCTAGTTAATCACATATATGG - Intergenic
1100796411 12:98186317-98186339 GTTCCCGTTGACCACATGGAAGG + Intergenic
1107967694 13:45612579-45612601 GTTCCAGGGGAGCTTATTTATGG + Intronic
1111883354 13:93986790-93986812 TTTACAGTTGTGCACATTTTGGG + Intronic
1111883890 13:93994431-93994453 GTTCCTATAGAGCACATTTTTGG + Intronic
1112584889 13:100709745-100709767 GTAAGTGTTGAGCACATTTAAGG - Intergenic
1113393881 13:109925477-109925499 CTTTCAGTTAAGCACACTTATGG + Intergenic
1115137489 14:30128411-30128433 TTTTCAGATGAGAACATTTAGGG + Intronic
1116576034 14:46576891-46576913 ATTACAGATGAACACATTTACGG + Intergenic
1117966831 14:61214908-61214930 GTTCTAGTTGAGCATATTTCTGG + Intronic
1119962091 14:78870402-78870424 ATTCCAGTTGTACATATTTATGG + Intronic
1124467525 15:29951580-29951602 GTTACATTTGAGTACATTTTTGG - Intronic
1127235942 15:57052214-57052236 GTTTCAGTTGAGTACATTCTTGG + Intronic
1128375670 15:67073582-67073604 TTTCCAGTTGAGAACATTCGAGG - Intronic
1138034021 16:53584237-53584259 ATTCCATATCAGCACATTTAAGG + Intergenic
1140573946 16:76141309-76141331 GTTTCAGTTGTGCCCATCTATGG + Intergenic
1141306317 16:82867137-82867159 TTTACAGGTGAGGACATTTAAGG + Intronic
1145050937 17:19659992-19660014 GATCCAGATGAGCACATGAAGGG + Intronic
1146134504 17:30306936-30306958 GTTCTAATTGAGGACTTTTAGGG - Intergenic
1149031688 17:52090791-52090813 GTTCCAGTTCATCTCATGTAGGG - Intronic
1152263346 17:79278908-79278930 GTTCTGGTTGAGCACTTTTGTGG + Intronic
1152442912 17:80320063-80320085 GTTCCAGTTCAGCAGGTTTTGGG + Intronic
1158497728 18:57971500-57971522 GTTTAAGTTGTGCATATTTAAGG + Intergenic
1159043432 18:63346163-63346185 GTTCCATTCCAGCACAATTAGGG + Intronic
1164521259 19:28982076-28982098 GTGCCAGTTAAGCACCTTCAGGG + Intergenic
1166647246 19:44541257-44541279 GTTCGAATTGAGCACATGGAGGG - Intergenic
927516715 2:23675867-23675889 GTTCCAGTGGATCACATTTGGGG + Intronic
928477302 2:31642092-31642114 GTCTCAGTTGATCACATTTGTGG - Intergenic
933213005 2:79593332-79593354 GCTACAGTTGAGGACAATTATGG + Intronic
935281153 2:101518992-101519014 TTTCCAGGTGAGCACATTTGGGG - Intergenic
936664929 2:114583656-114583678 GTTGCAGTTGATAATATTTAAGG + Intronic
937165769 2:119814998-119815020 TTTAGAGTTGAGCACAATTAAGG + Intronic
941636481 2:167940555-167940577 GTTCCTGCTGGGCACATTTTGGG + Intergenic
942306853 2:174617065-174617087 TTTTCAGTTCAGAACATTTAGGG + Intronic
947275218 2:228383572-228383594 GTTCCAGTTGAGAAGCTTTCAGG - Intergenic
1180932875 22:19605525-19605547 GTTCCAGTAAAGCTCATTTATGG - Intergenic
956513691 3:70022533-70022555 CTTTCAGTTGGGAACATTTATGG + Intergenic
957863195 3:85986331-85986353 GTTCTATTTGAGTACATTTATGG - Intronic
961928289 3:130506650-130506672 CATCCACTTGAGAACATTTATGG - Intergenic
963563594 3:146899494-146899516 GATCCAGTTGAGCTTATTTCTGG + Intergenic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
965033775 3:163407840-163407862 GTTACAGTTGTGCACTTTTTGGG - Intergenic
966542112 3:181103317-181103339 GTTGCAGTTCTGCGCATTTACGG + Intergenic
972747440 4:41951257-41951279 GTTCCTTTTGAGCACAGTTCAGG + Intronic
977858780 4:101929569-101929591 GTTACAGTTTAACCCATTTAAGG - Intronic
980635436 4:135495834-135495856 TTTCCAGTTGAGCCCCTTTCTGG - Intergenic
981529249 4:145735974-145735996 GTTCCAGTGAAGCATGTTTATGG + Intronic
981933233 4:150212012-150212034 GTTCCAGTTTAAGACTTTTAAGG + Intronic
982230576 4:153205095-153205117 GTACCCTTTGAGCACTTTTATGG - Intronic
983003475 4:162450745-162450767 ATTCCAGCTGAGCACATACATGG - Intergenic
987539480 5:19235510-19235532 GTTCAAAATGTGCACATTTAAGG - Intergenic
987546728 5:19320124-19320146 GTTCAGATTAAGCACATTTATGG - Intergenic
991127070 5:63081376-63081398 GTCCCAGGTGATCACCTTTATGG + Intergenic
992453235 5:76892082-76892104 GTTCCAGTTCTCCACATTGAAGG - Intronic
992888544 5:81183019-81183041 GTACTAGTTGAGTCCATTTAAGG + Intronic
997269511 5:132525064-132525086 GTTCCAGTTTCGCCCATTTGCGG + Intergenic
999146046 5:149395605-149395627 CTTCCAGTTGATGACATTTTAGG - Intronic
1002513802 5:179741794-179741816 GTTACAGTGGAACACATTTGAGG + Intronic
1005002014 6:21250975-21250997 GTACCAGTTGAGATTATTTATGG + Intergenic
1005984995 6:30866178-30866200 GTTCCAGTTCATCACAATAAAGG + Intergenic
1006680302 6:35792336-35792358 ATTCTGATTGAGCACATTTAAGG - Intronic
1006840221 6:37023645-37023667 ATTGCAGTTGAACACATTTTGGG - Intronic
1009831089 6:68936541-68936563 GTCCCAGTGGAGCACATGTTCGG + Exonic
1014151778 6:118065153-118065175 GTTCCATGTGATCACATTAATGG - Intronic
1016658156 6:146544059-146544081 GTCCCAGTTGAGGACCTTGAGGG - Exonic
1018551111 6:164999838-164999860 GTTCCAGTTGAGCAAATTTTGGG + Intergenic
1024604943 7:51015327-51015349 CTTCCAGATGAGCACACTGAAGG - Intergenic
1024905536 7:54374787-54374809 TTTCCTGTTGAGAAAATTTAAGG + Intergenic
1027399974 7:77797598-77797620 ATTTTAGTTGAGCACATTTTTGG - Intronic
1031521149 7:122767590-122767612 GTGCCAGCTGAGCAGAATTAGGG - Intronic
1033062645 7:138122997-138123019 GTCCCAGCTGACCACATTGAGGG - Intergenic
1035192779 7:157186785-157186807 GTTCCAGTTGAGCACATTTATGG + Intronic
1035484272 7:159210278-159210300 ATTCCTCTTGAGCACATTCAGGG + Intergenic
1036485099 8:9172260-9172282 GTTGCAGTTGATGACATCTAAGG + Intergenic
1042330773 8:67578360-67578382 GTTACATTTGAGCACTTTGAGGG - Intronic
1043836705 8:85055908-85055930 GTTCCAGTTGAGACCAAATAAGG - Intergenic
1045162794 8:99568075-99568097 GAACAAGTTGAGCACGTTTAAGG + Intronic
1054842439 9:69758141-69758163 GTTCTTGTGGATCACATTTATGG - Intronic
1056665419 9:88577394-88577416 GTTCCAGGTGAGCATGTCTACGG + Intronic
1057837795 9:98459743-98459765 ATTTCAGTTGAGAACATTGAAGG + Intronic
1059802652 9:117765790-117765812 GTACAAGTTGACCACAATTATGG - Intergenic
1185600680 X:1336859-1336881 GTTCCAGTTGAGAAGATCTGGGG - Exonic
1193927979 X:87514095-87514117 GTTCCAGTTAAGCACATGAAAGG + Intergenic
1198838646 X:140832413-140832435 CTTCCAGTTGATGACATTTCAGG + Intergenic