ID: 1035192779 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:157186785-157186807 |
Sequence | GTTCCAGTTGAGCACATTTA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 100 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 7, 4: 91} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1035192776_1035192779 | 22 | Left | 1035192776 | 7:157186740-157186762 | CCCGAAGAAAAATGTGATTTCGT | 0: 1 1: 0 2: 3 3: 26 4: 305 |
||
Right | 1035192779 | 7:157186785-157186807 | GTTCCAGTTGAGCACATTTATGG | 0: 1 1: 0 2: 1 3: 7 4: 91 |
||||
1035192777_1035192779 | 21 | Left | 1035192777 | 7:157186741-157186763 | CCGAAGAAAAATGTGATTTCGTA | 0: 1 1: 0 2: 0 3: 25 4: 263 |
||
Right | 1035192779 | 7:157186785-157186807 | GTTCCAGTTGAGCACATTTATGG | 0: 1 1: 0 2: 1 3: 7 4: 91 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1035192779 | Original CRISPR | GTTCCAGTTGAGCACATTTA TGG | Intronic | ||