ID: 1035193029

View in Genome Browser
Species Human (GRCh38)
Location 7:157189159-157189181
Sequence CTGAATATGCCGAGGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035193029 Original CRISPR CTGAATATGCCGAGGAAGCT GGG Intronic
901693097 1:10986775-10986797 CTGAAAAGGCCTGGGAAGCTTGG - Intergenic
901727442 1:11253180-11253202 GAGAATATGGGGAGGAAGCTGGG - Intronic
905824777 1:41019596-41019618 CAGAATATGCAGAGGAACCTGGG - Intronic
906078716 1:43069830-43069852 CTGAATGTGCAGAGGAATGTAGG + Intergenic
906837836 1:49103110-49103132 CTGAAAATGCTGAGGGAGATTGG - Intronic
910212785 1:84810614-84810636 CTCAGTATGCTGATGAAGCTGGG + Intergenic
918039976 1:180908084-180908106 CTCAATATGTTGAGGAAGCAGGG + Intergenic
1062987924 10:1786568-1786590 GTGCAGATGCAGAGGAAGCTGGG + Intergenic
1066340198 10:34525250-34525272 CTTAATATGCTGATGAAGCGTGG - Intronic
1067074923 10:43172538-43172560 CTGAGTAGGCCCAGGAGGCTGGG + Intronic
1072847798 10:98851602-98851624 CTCAAAATGCAGAGGAATCTGGG - Intronic
1073570181 10:104574621-104574643 GTGAATATGCCAATGCAGCTGGG + Intergenic
1074700465 10:116087713-116087735 CTGAATGGGCCCAAGAAGCTTGG + Intronic
1077507528 11:2937791-2937813 GTGAATATGCTGAGTATGCTCGG + Intergenic
1077545068 11:3165539-3165561 CTGAAAATGGCCAGGAGGCTTGG + Intronic
1085960064 11:81451173-81451195 CTGAACATGGAGAGGTAGCTGGG + Intergenic
1086663886 11:89456547-89456569 CTGAACTTGAGGAGGAAGCTGGG + Intronic
1087477301 11:98652186-98652208 TTGAATATTGTGAGGAAGCTTGG + Intergenic
1090319795 11:125832362-125832384 CTGAAAATGTTGAAGAAGCTTGG - Intergenic
1091001680 11:131915243-131915265 CTGAATAGTCCTGGGAAGCTTGG - Intronic
1095229545 12:39722882-39722904 CTTTATTTGCCTAGGAAGCTTGG + Intronic
1096876351 12:54633184-54633206 CTGATCCTGCCCAGGAAGCTGGG - Exonic
1096992732 12:55818234-55818256 ATGAACATGAGGAGGAAGCTGGG + Intronic
1097896938 12:64834166-64834188 TTTAATATGCAGAGGAAGGTTGG + Intronic
1098570365 12:71981362-71981384 CTGACTATGCCTAAGAACCTTGG - Intronic
1099456589 12:82870169-82870191 CTCAATTTCACGAGGAAGCTTGG - Intronic
1105500926 13:20971090-20971112 CTGAATATGCCAAGAAGGCAAGG - Intergenic
1118937028 14:70297819-70297841 CTAACTATGCCGAGGAAGAAAGG + Intergenic
1119090595 14:71777574-71777596 CTGAAAATGCCTATGAAGCAAGG + Intergenic
1121163954 14:91774066-91774088 GTGAAGATCCAGAGGAAGCTAGG + Intronic
1121300043 14:92862861-92862883 CTGAGTATGCCAAGGCACCTGGG + Intergenic
1129893884 15:79089923-79089945 CTGGAGATGCAGAGGAAGATGGG - Intronic
1130339268 15:82985623-82985645 CTTAATATCCCGACAAAGCTTGG - Intronic
1133346799 16:5076544-5076566 CTCAAGATGCAGAGAAAGCTCGG - Intronic
1137812260 16:51364127-51364149 CTGGAGATGCCGAGGAAGAGAGG + Intergenic
1147578933 17:41617808-41617830 CTGAATAGTCCCAGGAAGCAGGG - Intergenic
1148324068 17:46773167-46773189 CTGGATATGCCCAGGAATCATGG - Intronic
1152430824 17:80247513-80247535 CAGAAAATGCCAAGTAAGCTAGG - Intronic
1155838023 18:30612091-30612113 CTGGATATGCCAAGGAAGAAAGG + Intergenic
1163487904 19:17599901-17599923 CGGAATTTACCGAGGAAACTGGG + Intergenic
927710486 2:25322707-25322729 CTGAAGATGGAGAGGAGGCTTGG - Intronic
930302144 2:49629956-49629978 CTGTGTTTGCTGAGGAAGCTGGG + Intergenic
933576388 2:84073511-84073533 CTGACTATGCTGAGGCAGCAAGG + Intergenic
940733367 2:157420218-157420240 CTTAAGAGGCCGAGGAGGCTGGG + Intronic
946055312 2:216895933-216895955 CTGAATCTCCCCAGGCAGCTTGG + Intergenic
946132956 2:217621877-217621899 CTGTAAATGCAGTGGAAGCTGGG + Intronic
1171934144 20:31257640-31257662 CTGAGTGTGCTGGGGAAGCTGGG - Intergenic
1178529302 21:33361845-33361867 CTGAACATGCAGAGGCTGCTGGG + Intergenic
1184239083 22:43202394-43202416 CTGAAAATCCCAAGGAACCTGGG - Exonic
1185323094 22:50210818-50210840 CAGAAGATGCGCAGGAAGCTGGG + Exonic
950184777 3:10938283-10938305 CTGAAAATGCGGGGCAAGCTTGG + Exonic
950445735 3:13036654-13036676 CTGGATGAGCCCAGGAAGCTCGG + Intronic
951865942 3:27307740-27307762 CTGAATATGATGAGTCAGCTTGG - Intronic
952258247 3:31714018-31714040 CTGAAGATTCTGAGGAGGCTGGG + Intronic
955471382 3:59290074-59290096 CTGTCTATGCCAAGGTAGCTGGG + Intergenic
960723263 3:120645308-120645330 CCAAATATGCAGAGGAAGGTGGG - Intronic
964645051 3:158949943-158949965 GTGAATAGGCTGAGGAAGCTTGG + Intergenic
967255348 3:187586314-187586336 CTGAATATGCAGAGGAATCCAGG - Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
981721985 4:147811086-147811108 CTGAAAATGAAGAGGAAGCCAGG - Intronic
982127009 4:152192868-152192890 CGGAACAGTCCGAGGAAGCTGGG - Intergenic
983071771 4:163276055-163276077 CTGCTTATGGCGAGGAACCTTGG - Intergenic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
986442037 5:7791493-7791515 CTGAATATTTCCAGGAAGATGGG - Intronic
988607272 5:32689527-32689549 CTGAATATAACCGGGAAGCTAGG + Intronic
990387716 5:55283596-55283618 CTGAAGATCCCGAGGAATCTTGG - Exonic
991625047 5:68592536-68592558 CACAATATACCCAGGAAGCTAGG - Intergenic
1000039069 5:157471691-157471713 CTGAACCTGCTGGGGAAGCTGGG + Exonic
1000291321 5:159874134-159874156 CTGAAGATTCCCAGGATGCTTGG + Intergenic
1000618476 5:163456980-163457002 CTGAATATGCAGCGGATCCTTGG - Exonic
1003847979 6:10193790-10193812 CTGAATAGGCCCAGAAAACTGGG - Intronic
1006365326 6:33611698-33611720 CTGGATAGGAGGAGGAAGCTGGG - Intergenic
1007196223 6:40063119-40063141 CTGAATAGGCCCAGGAACTTGGG + Intergenic
1011503203 6:88013340-88013362 CTGAATATGCTGGGAAAGCTTGG + Intergenic
1012922402 6:105233783-105233805 CTGAAAGTGCTAAGGAAGCTGGG - Intergenic
1014820811 6:125986696-125986718 CTGCATAGCCCGAGGAAGCTGGG + Intronic
1018136645 6:160784382-160784404 CTGAAAATGCTCAGGAAGCTGGG - Intergenic
1025148898 7:56530277-56530299 TTGAATATGCTGATGAAGTTGGG - Intergenic
1031989743 7:128189778-128189800 CTGAAGGTGCCCAGGAAGCTGGG + Intergenic
1035193029 7:157189159-157189181 CTGAATATGCCGAGGAAGCTGGG + Intronic
1045398803 8:101790248-101790270 GGGAATATGCCAAGGAAGTTGGG - Intronic
1049930293 9:449677-449699 CTGAATTTGAAGAGGCAGCTAGG - Intronic
1050156883 9:2676740-2676762 TTTAATATGCCCAGGAAGCACGG - Intergenic
1053309510 9:37007797-37007819 CTAAATATGCCCAGGAATGTTGG - Intronic
1057013831 9:91632824-91632846 CTGAATCTGCAGAGGAGGCCAGG + Intronic
1057250677 9:93499017-93499039 CTGAGTCTGCCCAGGAAGTTTGG - Intronic
1057727509 9:97578615-97578637 ATGAATAAGCCGAGGGAGCATGG + Intronic
1059834257 9:118132498-118132520 CTGAATTTGTCAAGGCAGCTGGG - Intergenic
1187472616 X:19582445-19582467 CTGAAGATACCGAGGAAGGAGGG - Intronic
1188888733 X:35583245-35583267 ATGAAGATGCCAAGGAGGCTTGG + Intergenic
1193094210 X:77528493-77528515 CTGGAGAAGCCGAGGAAACTAGG + Intronic
1201588060 Y:15583386-15583408 CTGAATATGCCCAGGATGATGGG - Intergenic