ID: 1035195953

View in Genome Browser
Species Human (GRCh38)
Location 7:157220667-157220689
Sequence GAACCAGGATTGCCCCCGAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 41}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035195953 Original CRISPR GAACCAGGATTGCCCCCGAC AGG Exonic
906206748 1:43991274-43991296 GAACCAGGATGGCCCGGGTCAGG - Intergenic
920534021 1:206725753-206725775 GAACCTCGATCGCCCCCTACAGG - Intronic
921352879 1:214255696-214255718 AAACTATGATTGCCCCAGACTGG - Intergenic
1062929369 10:1342325-1342347 GAACCAGGACTGACACCAACAGG + Intronic
1069283824 10:66688918-66688940 GAGCCAAGATTGCCCCAGCCTGG + Intronic
1074917119 10:117968444-117968466 GCACCAGGATTACCTCTGACAGG + Intergenic
1077302992 11:1855687-1855709 GAGACAGGAGTGCCCCCGAGTGG - Intronic
1079023032 11:16924646-16924668 GCACCAGCACTGCCCCCGAAGGG - Intronic
1079298912 11:19259922-19259944 GGACCAGGAGTGCCACCTACTGG - Intergenic
1080453254 11:32396217-32396239 GAACCATGTTTGCCCAAGACTGG + Intronic
1080677425 11:34440441-34440463 GAACCAGGATTTGCACCCACTGG - Intronic
1080746825 11:35115740-35115762 GACCCAGGAGTGCCCCGCACTGG + Intergenic
1092486069 12:8903063-8903085 GAACCAAGATTGCTCCAGCCTGG - Intergenic
1116263906 14:42663265-42663287 GAACCGTGATGGCCCCCTACAGG + Intergenic
1116561409 14:46384394-46384416 GAAACAGTATTGCCCCCAAAGGG + Intergenic
1124250630 15:28104595-28104617 GAACAAGGAAGGCCCCTGACAGG - Intergenic
1126180842 15:45783745-45783767 GCATCAGGACTGCCCTCGACAGG + Intergenic
1132110507 15:99099238-99099260 GAGGCATGCTTGCCCCCGACAGG - Intronic
1142238655 16:88935186-88935208 AACCCAGGACTGCCCCTGACCGG - Intronic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1152038170 17:77885913-77885935 GCACCAGGATTGCCTCAGATGGG + Intergenic
1158194917 18:54874053-54874075 GCACCAGTATTGCCCCAGGCAGG + Intronic
1161297365 19:3526687-3526709 GACCCAGTACTGCCCCCTACGGG - Intronic
929483953 2:42338581-42338603 GAACCAAGAATCCCCCCGATAGG + Intronic
929507069 2:42536521-42536543 GAAGCAGGATTGCCTCGGAAAGG - Intronic
1180142556 21:45901143-45901165 GGACCAGGCCTGCCCCCGCCAGG - Intronic
1185019592 22:48366485-48366507 GAACCAGGATGGCCCAGGATGGG - Intergenic
967751708 3:193122869-193122891 GAAGCAGGGTTGCCCCAGAGAGG + Intergenic
968973581 4:3809722-3809744 GAATCAGGACTGGCCCCGAGAGG + Intergenic
976834667 4:89357615-89357637 GAATCAGGATTGCGCCCCAGGGG - Intergenic
984587811 4:181582774-181582796 GCACAAGGACTGCCCCCTACTGG + Intergenic
1002194565 5:177495022-177495044 GAGCCCGGAGTGCCCCCAACAGG + Intronic
1019876710 7:3818684-3818706 GAACCAGGAAGTCCCCAGACAGG + Intronic
1020087679 7:5320361-5320383 GGACCAGGATTGCAGCCTACTGG - Exonic
1025206636 7:56996805-56996827 GGACCAGGATTGCAGCCTACTGG + Intergenic
1025665304 7:63580122-63580144 GGACCAGGATTGCAGCCTACTGG - Intergenic
1035195953 7:157220667-157220689 GAACCAGGATTGCCCCCGACAGG + Exonic
1037591909 8:20319781-20319803 GAACCAAGATTGCACCAGCCTGG + Intergenic
1039973280 8:42338478-42338500 GAACAATGGTTGCCCCCGATGGG - Exonic
1041101348 8:54399089-54399111 GTACCATCATTGCCCCCCACAGG - Intergenic
1049820905 8:144632626-144632648 GCAGCAGGATTGCCACCAACTGG + Intergenic
1062012216 9:134273300-134273322 GATCCAGCCTTGCCCCAGACAGG + Intergenic