ID: 1035197873 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:157238266-157238288 |
Sequence | ACTCCTGGCGTCACCAGCAG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 143 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 12, 4: 129} |
Found 0 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary |
---|
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1035197873 | Original CRISPR | ACTCCTGGCGTCACCAGCAG AGG | Intronic | ||