ID: 1035197873

View in Genome Browser
Species Human (GRCh38)
Location 7:157238266-157238288
Sequence ACTCCTGGCGTCACCAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035197873 Original CRISPR ACTCCTGGCGTCACCAGCAG AGG Intronic