ID: 1035199178

View in Genome Browser
Species Human (GRCh38)
Location 7:157249243-157249265
Sequence GTGGCTGCCTGCGGGAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 1, 2: 2, 3: 54, 4: 431}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035199178_1035199187 1 Left 1035199178 7:157249243-157249265 CCCCACCTCCCGCAGGCAGCCAC 0: 1
1: 1
2: 2
3: 54
4: 431
Right 1035199187 7:157249267-157249289 AGTCCACTCTGTCTCTGCATGGG 0: 1
1: 0
2: 0
3: 19
4: 169
1035199178_1035199189 11 Left 1035199178 7:157249243-157249265 CCCCACCTCCCGCAGGCAGCCAC 0: 1
1: 1
2: 2
3: 54
4: 431
Right 1035199189 7:157249277-157249299 GTCTCTGCATGGGCCTGCTGTGG No data
1035199178_1035199186 0 Left 1035199178 7:157249243-157249265 CCCCACCTCCCGCAGGCAGCCAC 0: 1
1: 1
2: 2
3: 54
4: 431
Right 1035199186 7:157249266-157249288 CAGTCCACTCTGTCTCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035199178 Original CRISPR GTGGCTGCCTGCGGGAGGTG GGG (reversed) Intronic
900125402 1:1066937-1066959 GTGGGTGTGTGCGGGAGGCGGGG + Intergenic
900186091 1:1333923-1333945 GTGGCTGCCTGCGGGGGCCCTGG + Exonic
900405476 1:2491049-2491071 GTGGCTGCCTGCAGGCCCTGAGG + Intronic
900415514 1:2532742-2532764 ATGGCGGCCTGCCGGAGGTGAGG + Intergenic
900607814 1:3531529-3531551 GCGGCCCCCTGGGGGAGGTGGGG - Intronic
901427784 1:9193811-9193833 GGGTCTGTCTGCTGGAGGTGGGG - Intergenic
901778420 1:11576496-11576518 GGGGCAGGCTGCGGGAGCTGTGG - Intergenic
902518021 1:17000240-17000262 GTGCCGGCCAGGGGGAGGTGAGG - Exonic
902689113 1:18098685-18098707 GTGGAGGCCTGAGTGAGGTGAGG + Intergenic
903247349 1:22025708-22025730 GTGGCTGCCTGCCCCAGGAGCGG + Intergenic
903318522 1:22527375-22527397 GTGGCGGCCTGCGGGAGGTGAGG - Exonic
903653243 1:24933569-24933591 CAGGCTGCCTGGGGGAGGTAAGG + Intronic
903867632 1:26410697-26410719 GGGGCTGCCCGCGGGGGGTTGGG + Intergenic
904077991 1:27854393-27854415 GTGGCCCCGTCCGGGAGGTGAGG + Intergenic
904586878 1:31585607-31585629 GGTGCTGCCTGTGGGAGGGGGGG - Intronic
904591621 1:31618223-31618245 GGGGCTGAGTGCGGGAGGAGGGG + Intronic
905274110 1:36806073-36806095 GGGGCTGCCTGTGGGAGGGGTGG - Intronic
905339230 1:37266871-37266893 GTGCCTGTGTGGGGGAGGTGGGG - Intergenic
905368780 1:37471532-37471554 GTCACTGCCTGAGGGTGGTGGGG - Intergenic
905480160 1:38256302-38256324 GTGTTTGCCTGCAGGAGCTGAGG - Intergenic
905512436 1:38532614-38532636 GTGGTTGCCTCTGGGTGGTGGGG - Intergenic
905796535 1:40819288-40819310 GTGCCTGCCTGGGAGATGTGGGG - Intronic
906195329 1:43926919-43926941 GTTGATGCCTGTGGAAGGTGGGG - Intronic
906296095 1:44650028-44650050 GAGCCTGCCTGGGGGAAGTGGGG + Intronic
907251318 1:53141705-53141727 GGGGCAGCCTGGGGGAGATGCGG - Intronic
907454116 1:54564382-54564404 CAGGTTGCCTGCGGGGGGTGGGG + Intronic
908254567 1:62292491-62292513 ATGGCTTCCTGGGGGAGGTGGGG - Intronic
911726112 1:101242741-101242763 GTGGCTGGCTTTGGGAGATGGGG + Intergenic
913111499 1:115661346-115661368 GTGGTTGCCTTGGAGAGGTGAGG - Intronic
913320898 1:117587714-117587736 GGGGCTGCCAGCAGGATGTGGGG + Intergenic
914431317 1:147622277-147622299 CTGGCTGGCTGTAGGAGGTGGGG - Exonic
915245093 1:154551058-154551080 GTGACAGCCTGCAGAAGGTGAGG - Intronic
915458418 1:156055008-156055030 GCGGCTCCCTGAGGGAGGGGTGG + Intronic
917375671 1:174349319-174349341 GTGGCCCCATCCGGGAGGTGAGG - Intronic
917375770 1:174349546-174349568 GTGGCCCCGTCCGGGAGGTGAGG - Intronic
919939703 1:202277840-202277862 GAGGCTTCCTGGGGGAGGTGGGG + Intronic
920831016 1:209465725-209465747 TTGGCTGCTTACAGGAGGTGTGG + Intergenic
921160916 1:212471606-212471628 GTGCCTGCATGGGGGAGGAGGGG - Intergenic
921329087 1:214017673-214017695 GTGGGGGGGTGCGGGAGGTGAGG - Intronic
922460518 1:225811435-225811457 GTGGCTGGAGGTGGGAGGTGAGG + Intronic
922606158 1:226891213-226891235 GTGGCTGCCTGCAGGGCCTGGGG - Intronic
922861171 1:228818154-228818176 GTGGCTGCAGCAGGGAGGTGTGG + Intergenic
923017950 1:230141454-230141476 GTGGTTGCCAGGGGGAGGGGAGG - Intronic
923273868 1:232380064-232380086 GTGGGGGCCTGAGGCAGGTGTGG + Intergenic
924426153 1:243952214-243952236 CAAGCTGCCTGGGGGAGGTGGGG - Intergenic
1063278295 10:4595825-4595847 GTGGCGGGATGAGGGAGGTGGGG + Intergenic
1063566544 10:7176230-7176252 GTTGCTGCCTTCGGAATGTGTGG - Intronic
1067065078 10:43099711-43099733 CTGGCTGCCTGTGGCAGGCGGGG - Intronic
1067496010 10:46760868-46760890 GTGGCTCCCGCCTGGAGGTGAGG + Intergenic
1067598646 10:47579522-47579544 GTGGCTCCCGCCTGGAGGTGAGG - Intergenic
1067705194 10:48601412-48601434 GTGGCTGCCTCTGTGGGGTGGGG - Intronic
1068661940 10:59631782-59631804 GTGGATGCCTCTGGGAAGTGAGG + Intergenic
1069104729 10:64369376-64369398 GTGGTTGCCTATGGAAGGTGGGG - Intergenic
1069618646 10:69822518-69822540 GTGACGGCCTGAGTGAGGTGTGG - Intronic
1069741056 10:70687148-70687170 GTGGCCCCGTCCGGGAGGTGAGG - Intronic
1069770019 10:70892557-70892579 GTGACTACCTGGGGGAGCTGAGG - Intergenic
1070278387 10:75029948-75029970 GTGTCAGACTGCTGGAGGTGAGG - Exonic
1070642373 10:78179148-78179170 AAGGCTGCCTGGAGGAGGTGTGG + Intergenic
1070671083 10:78377604-78377626 GGGGCTCCCTGTGGGTGGTGAGG + Intergenic
1071612383 10:87043433-87043455 GTGGCTCCCGCCTGGAGGTGAGG + Intergenic
1072574999 10:96691234-96691256 GTTGCTGTTTGCGGGAGGTGGGG - Intronic
1072610069 10:97011883-97011905 GAGGCTTCCTGGAGGAGGTGAGG - Intronic
1072648716 10:97276727-97276749 GTGGCCCCGTCCGGGAGGTGAGG + Intronic
1073177699 10:101566516-101566538 GCGGCTGACAGCGGGAGGGGGGG - Intergenic
1075091730 10:119447572-119447594 CTGGCTGCCAGCTGGAGGTCAGG - Intronic
1075269410 10:121035679-121035701 GGGGCTGCCTGCGGCACTTGCGG - Intergenic
1075310687 10:121411235-121411257 TTTGCTGCCTCTGGGAGGTGGGG - Intergenic
1075399131 10:122149115-122149137 GTGGCTGCCTTGGTGAGGTGAGG - Intronic
1075714370 10:124547648-124547670 CTGGCTGCCTGGTGGAGGTCGGG + Intronic
1076341112 10:129745373-129745395 GTGGCTGCCAGGGGGCGGCGTGG - Intronic
1077052084 11:571518-571540 GTGGATGCCTGGGGGAGGCAGGG - Intergenic
1077095056 11:795720-795742 GGGGCTGGCTGTGGGGGGTGTGG - Intronic
1077107709 11:849204-849226 GGGGCTGCCTGGTGGAGGGGGGG + Intronic
1077173873 11:1180118-1180140 GAGACTGCCTGCGGGACGTCCGG + Intronic
1077223326 11:1426910-1426932 GGGTCTGCATGCGGGAGATGGGG + Intronic
1077228193 11:1447401-1447423 CTGGCTGCCTGGGGCAGGTGTGG + Intronic
1077343793 11:2037347-2037369 GAGGCTCCCTGGGGGCGGTGGGG + Intergenic
1077460599 11:2707456-2707478 GGGGCTGCCTGGGGGTGGGGTGG - Intronic
1077463134 11:2720900-2720922 TTGGCTACCTGAGGGAGATGAGG + Intronic
1077551030 11:3200451-3200473 GGGGCTTCCTGCAGGAGGTAAGG - Intergenic
1078106891 11:8363458-8363480 GTGGTTACCTGGGGGAGGTGGGG - Intergenic
1078150621 11:8756721-8756743 GGGGCTGCTTGTAGGAGGTGGGG - Intronic
1080116774 11:28630329-28630351 GTGGCTGCCTGAGCGAGGGAGGG - Intergenic
1082284186 11:50301737-50301759 GCCGCTGCCTGAGTGAGGTGAGG - Intergenic
1082788360 11:57330186-57330208 CTGGGTGCCTGGGTGAGGTGGGG - Intronic
1083382658 11:62279555-62279577 GTGGCCCCGTCCGGGAGGTGAGG + Intergenic
1083453446 11:62762013-62762035 CTGGCTGCCTGAGAGAGGAGAGG - Intronic
1083602651 11:63958463-63958485 GTGGCTGCTTCAGTGAGGTGTGG + Intergenic
1083610714 11:64002899-64002921 GGGGCTACCTGGTGGAGGTGGGG + Intronic
1083645748 11:64171614-64171636 GTGGCCCCGTCCGGGAGGTGAGG - Intergenic
1083668444 11:64287641-64287663 GGGGTTTCCTGCAGGAGGTGGGG + Intronic
1084004607 11:66316364-66316386 GAAGCAGCCTGAGGGAGGTGTGG - Exonic
1084155607 11:67311091-67311113 GAGGCTTCCTGGAGGAGGTGTGG + Intronic
1084263864 11:67995261-67995283 GTGGCTACATGGGGCAGGTGTGG - Intronic
1084329167 11:68420220-68420242 GTGGCTGTCAGAGGGAGATGAGG - Intronic
1084383036 11:68825695-68825717 GAGGCTGGCTGGGTGAGGTGGGG - Intronic
1084421999 11:69065168-69065190 GTGCCTGTCTGTGGGTGGTGGGG + Intronic
1084512678 11:69615995-69616017 GGGGCTGCCTGCAGGAGGGCAGG - Intergenic
1084957464 11:72698951-72698973 GTGTCTGACTGGGGAAGGTGGGG - Intronic
1085294580 11:75423933-75423955 GTGGCAGCATGTGGGCGGTGGGG - Intronic
1089270910 11:117300642-117300664 GTGGTTGGCTGTGGGAGATGAGG - Intronic
1089529419 11:119116731-119116753 GTGGGGACCTGAGGGAGGTGTGG - Exonic
1202826779 11_KI270721v1_random:92536-92558 GAGGCTCCCTGGGGGCGGTGGGG + Intergenic
1091401208 12:181879-181901 GGGGCAGCAGGCGGGAGGTGTGG + Intergenic
1092777346 12:11955553-11955575 GTGGCTGCCTGCTGGAGTGGAGG - Intergenic
1096418344 12:51433075-51433097 GTGGCTGCTTCCAGGAGCTGGGG + Intronic
1096498335 12:52051290-52051312 GAGGCGGCCAGGGGGAGGTGCGG - Intronic
1097183786 12:57185516-57185538 GTTGGTGCCTGGGGGAGGGGAGG - Exonic
1097198012 12:57254970-57254992 GGGGCTGCCTGGAGGGGGTGGGG - Exonic
1100582444 12:95948389-95948411 GTGGCCCCGTCCGGGAGGTGAGG + Intronic
1101425702 12:104586370-104586392 ATGCCTGCCTGAGTGAGGTGGGG + Intronic
1101828720 12:108240738-108240760 GGTGCTGCTTGTGGGAGGTGGGG - Intronic
1103980561 12:124734414-124734436 GAGGCAGCCTGCGGGGGGCGTGG + Intergenic
1104245381 12:127035293-127035315 GTGGCAGCCTGGGAGATGTGTGG - Intergenic
1104856075 12:131903105-131903127 GTCGCTGCCTGTGGGAAGGGTGG + Intronic
1105013437 12:132771455-132771477 CTGGCTGACTGGGAGAGGTGGGG - Exonic
1105827316 13:24134028-24134050 GTGGTTGCTGGCGGGAGGTGGGG + Intronic
1105833883 13:24192038-24192060 GTGGTGGCCTGGGTGAGGTGGGG - Intronic
1106375634 13:29184302-29184324 GTGACTGCCTTTGGAAGGTGAGG - Intronic
1108944059 13:55999571-55999593 ATGGCTCCCTGGGGGAGGTTTGG - Intergenic
1109164197 13:59012968-59012990 GTTGCTGCCGGAGGGAGGAGAGG + Intergenic
1112406376 13:99124161-99124183 GTGAATGCCAGTGGGAGGTGGGG - Intergenic
1113574459 13:111384118-111384140 CTGGCAGCCGGCGGGAGGTATGG - Intergenic
1113901546 13:113800896-113800918 CTCTATGCCTGCGGGAGGTGAGG + Exonic
1113914583 13:113863076-113863098 GGGGCCGCATGCGGGAGGGGAGG - Intronic
1114492749 14:23113591-23113613 GGGTCTGTCTGCGGGGGGTGGGG + Intergenic
1114664633 14:24370258-24370280 GTGGCAGCCTGGGGGAAGAGGGG + Exonic
1115646606 14:35372456-35372478 GTTGCTGCCTGCTGGAGGGTGGG + Intergenic
1115799226 14:36973381-36973403 GAGGCTGCCTCCGTGGGGTGTGG + Intronic
1115958814 14:38811357-38811379 CTGGCTGCCTGCGGGCTGGGTGG - Intergenic
1116441747 14:44962259-44962281 GAGGCTGCCTCCCGGAGTTGGGG + Exonic
1117325808 14:54667998-54668020 GTGGCAGCCTGCGGGAGGGCCGG - Intronic
1117802275 14:59456985-59457007 GTGGTTGCCTGAGAAAGGTGAGG + Intronic
1117868024 14:60169638-60169660 GTGGCTGCCTAGGGAAGGGGTGG - Intronic
1118477969 14:66136081-66136103 GAGGCAGCCTGCGGCATGTGAGG + Intergenic
1118500812 14:66360794-66360816 GTGTCTGCCTGGGAGGGGTGGGG + Intergenic
1119035939 14:71230901-71230923 TTGGCTGCCTCAGGGACGTGGGG - Intergenic
1119669309 14:76506630-76506652 CTGTCTGCCTGTGGGAGGAGGGG - Intergenic
1121124958 14:91400019-91400041 ATGTCTGCCTGCGGCTGGTGGGG - Intronic
1121319656 14:92984154-92984176 GTGGCTGCCTCAGGGAAGTGAGG + Intronic
1121507158 14:94486024-94486046 AAGGCTGCCTGCGGGTGATGGGG - Intergenic
1121640350 14:95481042-95481064 GGGGCTGACTGGGGCAGGTGTGG + Intergenic
1121727354 14:96162515-96162537 GGGGAAGCCTGTGGGAGGTGAGG - Intergenic
1121810606 14:96885247-96885269 GTGGTTGCCTGTGGGTGGTAGGG - Intronic
1122092112 14:99347702-99347724 GTGGCTGCCTGGGGATGGGGAGG - Intergenic
1122487708 14:102092588-102092610 CTGGTTGCCTGTAGGAGGTGGGG + Intronic
1122771208 14:104098710-104098732 GTCTCTGCCTGCGGTGGGTGGGG + Intronic
1122863912 14:104594987-104595009 AAGGCTTCCTGCAGGAGGTGGGG - Intronic
1122866176 14:104604956-104604978 AGGGCGGCCTGCGGGAGATGCGG + Exonic
1123059438 14:105587849-105587871 GTGGCAGCATGGGGGAGGTGGGG + Intergenic
1123083765 14:105708080-105708102 GTGGCAGCATGAGGGAGATGGGG + Intergenic
1123109032 14:105856734-105856756 TTGGCTGCCTGCGGGGTGTGTGG - Intergenic
1124826233 15:33098617-33098639 TTGTCTACCTGCGTGAGGTGTGG - Intronic
1125760132 15:42090651-42090673 GTGAATGCCGGCTGGAGGTGAGG + Intronic
1126073035 15:44882628-44882650 GTGGCTGCCTGCCCGTGGTTTGG - Intergenic
1126228149 15:46295403-46295425 GTGGCTACCTGGGGAAGGTGGGG - Intergenic
1126545879 15:49873720-49873742 CTGCCTGGCTGCAGGAGGTGTGG + Intronic
1126672497 15:51128958-51128980 GTGCATGCATGTGGGAGGTGTGG - Intergenic
1126675678 15:51157771-51157793 GGGGCTGGCTGGGGGAGGGGTGG + Intergenic
1126773421 15:52079307-52079329 GTGGCTGTCTGTGGAAGGTAGGG - Intergenic
1128313376 15:66645371-66645393 AAGGCTGCCTGGAGGAGGTGGGG - Intronic
1128944262 15:71810704-71810726 CTGCCTGCCTGCGGGAGGCCTGG - Exonic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1130042128 15:80413802-80413824 GTGGCTGAGCGAGGGAGGTGGGG + Intronic
1130203266 15:81852719-81852741 GTGGCAGCCTCAGAGAGGTGAGG + Intergenic
1130317527 15:82809553-82809575 TTGGCTGGCTGCCGGAGGTGGGG - Intergenic
1130638370 15:85646792-85646814 GAGGCTGCCTAAGGGAGGTGGGG + Intronic
1131252873 15:90842102-90842124 ATGGCTTCCTGGAGGAGGTGTGG - Intergenic
1131256026 15:90863056-90863078 GTGCCTGCTTGGGGGAGGAGAGG - Intergenic
1132039182 15:98510881-98510903 GTGGCTGCCTGGGGCTGGGGAGG + Intronic
1132215156 15:100057048-100057070 GTGGCTGCCTGCAGTGTGTGAGG + Intronic
1132694206 16:1194800-1194822 GTGGCTGCTTTCAGGAGGGGCGG + Intronic
1132854230 16:2037717-2037739 GAGGCTGCCTGCTGGGGCTGGGG - Intronic
1133270749 16:4609820-4609842 GTGGCGGCATGGGGGAAGTGTGG + Exonic
1133737840 16:8629407-8629429 GAGGCTTCCTGGAGGAGGTGTGG - Intronic
1133928973 16:10216744-10216766 GTGGCTGGATGTGGCAGGTGTGG + Intergenic
1134529810 16:14974749-14974771 AGGGATGCCGGCGGGAGGTGAGG + Intronic
1134826342 16:17287500-17287522 GTGGCTGCCTGATTGGGGTGGGG - Intronic
1135973112 16:27086740-27086762 ATGGCAGTCTGCAGGAGGTGGGG - Intergenic
1136428607 16:30184677-30184699 GGGGCTGCCTGAGGGGAGTGAGG - Intronic
1136617832 16:31409565-31409587 GTGGCTCCCTGAAGGAGCTGAGG + Intronic
1137366215 16:47862033-47862055 GTGTCTGCCTTCGGGAGCTCTGG - Intergenic
1137487576 16:48904400-48904422 GTGGCTGACTTTGGAAGGTGGGG - Intergenic
1138781713 16:59796508-59796530 GAGGCTTACTGCGGGCGGTGGGG + Intergenic
1139866540 16:70066213-70066235 AGGGATGCCGGCGGGAGGTGAGG - Intergenic
1140737550 16:77911661-77911683 GTGGCTGTTTGTGGGAGGTGGGG + Intronic
1141125781 16:81399854-81399876 GTGGCTGCCCCCAGGAGATGGGG - Intergenic
1141705017 16:85660029-85660051 GTGGCTGCCTGCGGGGACAGTGG + Intronic
1141935621 16:87236164-87236186 GTGGCTGCCTGTGGTCGCTGCGG - Intronic
1142427949 16:90010806-90010828 CTGGCTGCCTGAGGCAAGTGAGG - Intronic
1142507672 17:375451-375473 GTGGCTGACTGCAGGGGGAGTGG + Intronic
1142507702 17:375557-375579 GTGGCTGACTGCGGGGGGAGTGG + Intronic
1142507744 17:375716-375738 GTGGCTGACTGCGGGGGGAGTGG + Intronic
1142507773 17:375822-375844 GTGGCTGACTGCGGGGGGAGTGG + Intronic
1142603224 17:1067433-1067455 GTTGCTCCCTGCGGGCGGGGCGG - Intronic
1142611251 17:1110040-1110062 GGGGCTGCTTGGAGGAGGTGGGG - Intronic
1143175287 17:4951552-4951574 GTGGAGGCTTGGGGGAGGTGGGG + Intronic
1144648459 17:16991144-16991166 GGGGCTGCCTGTGGGGTGTGTGG - Intergenic
1144727934 17:17511159-17511181 GTAGCTGGCAGCTGGAGGTGGGG - Intronic
1145037462 17:19551299-19551321 GTGGCTCCGTGCGGGAGCAGAGG + Intronic
1145201029 17:20944809-20944831 GTGGCTGCTGCCGGGAGATGAGG + Intergenic
1145296244 17:21594298-21594320 GTGACTGCCTGGAGCAGGTGTGG - Intergenic
1145367544 17:22277764-22277786 GTGACTGCCTGGAGCAGGTGTGG + Intergenic
1147138447 17:38448211-38448233 GAGGCTGGCAGTGGGAGGTGGGG + Intronic
1147429455 17:40362732-40362754 GTGGCTGCCGGCGGCACCTGGGG - Intronic
1147890922 17:43716284-43716306 GTGGCTGCCTGGGGTGAGTGTGG + Intergenic
1148335068 17:46835563-46835585 GAGGCTTCCTGGAGGAGGTGAGG - Intronic
1151674384 17:75590075-75590097 GTGGGTCCCTGAGGGAGCTGTGG + Intergenic
1151679460 17:75615871-75615893 GTGGCTGCCTGAGGGTGAGGAGG + Intergenic
1152121389 17:78420789-78420811 GTGGCTGCCTGGGGGAAGGGAGG - Intronic
1152224591 17:79086836-79086858 GGGGCTGCCTGCGGGATGGCGGG + Intronic
1152280126 17:79380196-79380218 TTGGCAGCCTGGGGGAGGGGTGG - Intronic
1152346798 17:79757494-79757516 GTGTCTGCCTTTGGGAGGTGGGG - Intergenic
1152468575 17:80478450-80478472 GCGGCTCCCTACGGGAGTTGGGG - Intergenic
1152746576 17:82043099-82043121 GTGCATGCCTGTGGGGGGTGTGG - Intergenic
1154333237 18:13446943-13446965 GTTGCTGACTGCAGGGGGTGTGG + Intronic
1155322344 18:24631939-24631961 GGGGCTGCCCATGGGAGGTGGGG - Intergenic
1159074938 18:63669767-63669789 GTGGCTACATGAGGGTGGTGGGG - Intronic
1159104783 18:63993742-63993764 CAGGCTGCATGGGGGAGGTGGGG + Intronic
1160262005 18:77302933-77302955 GTGGCTGCTTGCTAGATGTGTGG - Intergenic
1160693457 19:470955-470977 CCGGCTGCCTGCGGGAGGGCAGG - Intronic
1160715667 19:575513-575535 GTGCCTGGCTGCGGCCGGTGGGG + Intronic
1160860556 19:1235715-1235737 GTGGGTGCCATCGGGTGGTGGGG - Intronic
1160919111 19:1511720-1511742 GTGACACCCTGCGGAAGGTGCGG + Intronic
1161297545 19:3527384-3527406 AGGGCTGCCTGGAGGAGGTGTGG + Intronic
1161793871 19:6375609-6375631 GTGGGTGCCTGTGGGAGGGAAGG + Exonic
1162367332 19:10257421-10257443 GGGGCTTCCTGGAGGAGGTGTGG - Intronic
1162454883 19:10777479-10777501 GTGGCTGTCTGGGGGAAGTGTGG - Intronic
1162514278 19:11138778-11138800 GCGGCTGCCAGAGGGAGGTGGGG + Intronic
1162578097 19:11511069-11511091 GGGGCTTCCTGGGGGAGGTAAGG - Intronic
1162728306 19:12702768-12702790 CTGCCTGCCTTCTGGAGGTGGGG - Intronic
1162938429 19:13993710-13993732 GTGGGTGGCTGCGGGGGCTGGGG + Exonic
1163123994 19:15234316-15234338 GTGGCTGCTTCCGGGAGGAAGGG - Intergenic
1163314498 19:16532784-16532806 GTGGGTGCCTGGGGGAGCCGCGG - Intronic
1163373286 19:16914552-16914574 GGAGCTGCCTGGGGGAAGTGGGG - Intronic
1163386154 19:17001741-17001763 GTGTCTGCCTGTAGGAGGAGGGG + Intronic
1163790121 19:19301626-19301648 GTGGGTGCCTGGGGGATGTGAGG - Intronic
1163943682 19:20517078-20517100 GTGGCTATCTGGTGGAGGTGTGG + Intergenic
1164629824 19:29754847-29754869 GGGGCTGCCAACGGGAGGGGAGG - Intergenic
1164738236 19:30558283-30558305 GTGGATGACTGTGGGGGGTGGGG + Intronic
1164802509 19:31089383-31089405 GTGGCAGCCTGCTGGAGAGGAGG - Intergenic
1164888654 19:31804603-31804625 TTGGCTCCCTGGGTGAGGTGAGG - Intergenic
1165138973 19:33687969-33687991 GTCAGTGCCTGAGGGAGGTGAGG - Intronic
1165145847 19:33729575-33729597 GAGGCTGCCTGCCGCAGGTGAGG + Intronic
1165445033 19:35851861-35851883 GTGGCTGGCAGCGGGCGCTGTGG - Intronic
1165725145 19:38107407-38107429 GTGGCTGCCAGCAGGAGGCAGGG + Intronic
1165773289 19:38390353-38390375 CTGGCTGCCTGTGGGGGGCGGGG + Exonic
1166028215 19:40107950-40107972 GTGGCCCCGTCCGGGAGGTGAGG - Intergenic
1166798946 19:45444265-45444287 GCGGCTGGCTGGGGGAGGGGGGG - Intronic
1167050513 19:47075147-47075169 GTGGCTTCATGGAGGAGGTGTGG + Intronic
1167311876 19:48741640-48741662 GTGGCTTCCTGCCGGGGGCGTGG - Intronic
1167498212 19:49831318-49831340 GTGCCTGCCTGCCAGAGGGGAGG - Exonic
1167558401 19:50210275-50210297 GTGGCTGCCTGGGGAATTTGGGG + Intronic
1167696200 19:51016936-51016958 GTGGCCGCCAGGGGGCGGTGTGG - Intronic
925162899 2:1698476-1698498 GTGGCTGACTGAGGGAAGGGAGG + Intronic
925386175 2:3463382-3463404 GTGGCTGCCGGCGGGTGCAGGGG + Intronic
926126648 2:10276514-10276536 GTGGCAGCCATGGGGAGGTGAGG - Intergenic
926735535 2:16070718-16070740 GGGGGTGCCTGGGAGAGGTGGGG - Intergenic
926819499 2:16837057-16837079 GTGGCTGTCAGAGGGAAGTGAGG + Intergenic
927267211 2:21163510-21163532 TTGGCTGCCTTGGGGACGTGGGG + Intergenic
927496338 2:23554125-23554147 GTGGATGTTAGCGGGAGGTGGGG - Intronic
927943267 2:27118914-27118936 GAGGCTGGCGGCGGGAGGCGAGG - Exonic
930104181 2:47627347-47627369 GTGACTGCCTGGGTGTGGTGAGG + Intergenic
930844803 2:55891276-55891298 GTGGATCCCAGCAGGAGGTGGGG + Intronic
931656056 2:64511811-64511833 GTGGCCCCGTCCGGGAGGTGAGG - Intergenic
932421610 2:71604559-71604581 CTGTCTGGCTGCAGGAGGTGTGG + Intronic
932989678 2:76771523-76771545 GTAGCTGCCTGGAGGAGCTGAGG + Intronic
933706195 2:85292361-85292383 GTAGCTGCCTTTGGGAAGTGGGG + Intronic
934603767 2:95679025-95679047 AGGGCTGCCTTCGGGAGGAGAGG - Intergenic
934846290 2:97663446-97663468 CTGGCTGCCTGGCGGAGGTGGGG - Intronic
934990304 2:98915658-98915680 TGGGCTGCCTGCTGGGGGTGGGG + Intronic
936537147 2:113321255-113321277 AGGGCTGCCTTCGGGAGGAGAGG - Intergenic
937289356 2:120772826-120772848 GTGGCTGCATGCTGGAGAAGAGG - Intronic
938292934 2:130159933-130159955 GTGACTGCCGGCGGCAGGGGCGG - Intronic
941905893 2:170716101-170716123 GTGGGTGCGTGCGTGGGGTGCGG + Intronic
942301918 2:174571290-174571312 GAGCCCTCCTGCGGGAGGTGGGG + Intronic
944777618 2:202983139-202983161 GTGGCTCACTGCGTGAGGAGTGG - Intronic
947598129 2:231426874-231426896 ATGGCTGCCTACGGGTGTTGAGG - Intergenic
947815491 2:233033901-233033923 GTGGCTGCCTTGGAGGGGTGAGG + Intronic
948491798 2:238318221-238318243 GTGGCTGCCTGGGGCTGGGGTGG + Intergenic
948537000 2:238653886-238653908 GTGGGTGACTGTGGGTGGTGGGG + Intergenic
948598836 2:239096769-239096791 GTGGCTGTCTGTGGGACATGTGG - Intronic
948755015 2:240154648-240154670 GTGGGTGCTTCCAGGAGGTGGGG + Intergenic
948805196 2:240450915-240450937 GAGGCTTCCTGAGGGAGGTGAGG + Exonic
948809999 2:240469568-240469590 GGGGCTGCCTGCAGATGGTGTGG - Intergenic
948811582 2:240481109-240481131 GTGGCCGCCTGCTGACGGTGAGG - Intronic
1169073584 20:2748776-2748798 GTTGGTGCCTGCTGGGGGTGGGG + Intronic
1169113574 20:3048128-3048150 CTGGCTGCCTGAGGGGGCTGTGG - Exonic
1171494879 20:25548675-25548697 GGGGCTGGGTGTGGGAGGTGTGG - Intronic
1171494959 20:25548925-25548947 GAGGCTGGGTGTGGGAGGTGTGG - Intronic
1171494991 20:25549025-25549047 GAGGCTGGGTGTGGGAGGTGTGG - Intronic
1171495009 20:25549075-25549097 GAGGCTGGGTGTGGGAGGTGTGG - Intronic
1171495027 20:25549125-25549147 GAGGCTGGGTGTGGGAGGTGTGG - Intronic
1171495045 20:25549175-25549197 GAGGCTGGGTGTGGGAGGTGTGG - Intronic
1171495081 20:25549275-25549297 GAGGCTGGGTGTGGGAGGTGTGG - Intronic
1172482275 20:35278003-35278025 GGGTCTGGCTGCGAGAGGTGAGG - Intergenic
1172875059 20:38158996-38159018 GTGGCTGCCTACAGGGGCTGCGG + Intronic
1174051386 20:47769852-47769874 GTGGATCCCTGCAGGAGGGGAGG + Intronic
1175037640 20:56015403-56015425 GCAGCCGCCTGCTGGAGGTGAGG - Intergenic
1175337667 20:58206739-58206761 GTGGCTGGCTGGGGGAGGGGAGG - Intergenic
1175699823 20:61128877-61128899 GTGACTGCCTGCAGGTGCTGTGG + Intergenic
1175787946 20:61723862-61723884 GCGGCTCCATGCGGCAGGTGGGG + Intronic
1175972600 20:62694292-62694314 GTGGATACCTGGGGGAGGTCCGG + Intergenic
1176205882 20:63887871-63887893 CTGGCTGCCTGCAGTGGGTGGGG + Intronic
1176212911 20:63933931-63933953 GCAGCTCCCTGCGGAAGGTGGGG + Exonic
1178914031 21:36697243-36697265 GGGGCCGCCTGCGGAAGCTGCGG + Intergenic
1178916124 21:36706392-36706414 GTGGTTTCCTGCCGGAGGGGTGG - Intronic
1178920639 21:36736056-36736078 GTGGCTGCCCGAGGGATGCGGGG + Intronic
1179403784 21:41108768-41108790 GTGGCAGCCTGGGGGTGCTGGGG - Intergenic
1179998106 21:44983162-44983184 GTGGCTGCCGGCGGGCGGGGAGG + Intergenic
1180082704 21:45494006-45494028 GCGGCTGCCTGCTGGGGGTGGGG - Intronic
1180714207 22:17860450-17860472 TGGGGTGCCTGCGGGAGGGGCGG - Intronic
1182147282 22:28004326-28004348 CTGCCTGCCTGCGGGAGAGGGGG + Intronic
1183149935 22:36029020-36029042 GTGGCGGCCCGCGGGGGGGGCGG + Intergenic
1184070194 22:42142473-42142495 CGGGCTTCCTGCGCGAGGTGCGG - Intergenic
1185042328 22:48511426-48511448 GTGGCTCCCAGGGGGAGGGGAGG + Intronic
1185080301 22:48706027-48706049 GGGGCTGCAGACGGGAGGTGGGG + Intronic
1185273020 22:49937258-49937280 GCCGCTGCCTGCGGGTGGGGTGG - Intergenic
1185377082 22:50487585-50487607 GGGGCTGCCTGGGAGAGGGGAGG + Intronic
949880832 3:8659419-8659441 AAGGCTGCCTGGAGGAGGTGAGG - Intronic
952923844 3:38307430-38307452 GTGTCAGGCTGAGGGAGGTGAGG + Intronic
953502601 3:43452345-43452367 GTGGTTGCCTACGGGAGATAAGG - Intronic
953766924 3:45750113-45750135 GTGGCTTCCTGGAGGAGGTGGGG + Intergenic
953841541 3:46393790-46393812 CTGGCTTCCTGCAGGTGGTGTGG + Intergenic
953848150 3:46445116-46445138 GTGGCTGCCCCCTGGAGGCGTGG - Intronic
954378029 3:50205176-50205198 CTGGCGGCCCGCGGGAGGAGGGG - Intergenic
954401352 3:50321360-50321382 GTGGCGCCCCGCGCGAGGTGAGG - Exonic
954706906 3:52485729-52485751 GGGGCTGGCTGCAGTAGGTGGGG + Intronic
955842598 3:63128261-63128283 GCCACTGCCTGTGGGAGGTGGGG - Intergenic
961021390 3:123510159-123510181 GTGGTTACCTGGGGGCGGTGAGG - Intronic
961236828 3:125374915-125374937 GGGGCTGGCTGGGGGACGTGAGG - Intronic
961736531 3:129005220-129005242 GTGGCAGCAGGCAGGAGGTGGGG + Intronic
962245241 3:133785523-133785545 GTGGCCCCGTCCGGGAGGTGAGG + Intronic
963836331 3:150061548-150061570 GTGGCTGCCATAGGGAGATGAGG - Intergenic
964726270 3:159817308-159817330 GTGGCGGGCTGCGGGTGGCGGGG + Intronic
965793330 3:172411796-172411818 GTGGCGGGCTGCGGGAGGCGGGG + Intergenic
967885722 3:194332177-194332199 GTGGGTGCCTGCTGGAGAGGCGG + Intergenic
968081484 3:195849545-195849567 GCGGCTGGCTGCGGCAGGGGTGG + Intergenic
968087032 3:195878440-195878462 GGGACTTCCTGCTGGAGGTGAGG - Exonic
968607928 4:1544243-1544265 GTGCTGTCCTGCGGGAGGTGAGG + Intergenic
968649522 4:1754946-1754968 GAGGCTTCCTGGGGGAGGTGGGG + Intergenic
968698439 4:2043587-2043609 GTGGACCCCTGCGGGTGGTGTGG + Intronic
968746091 4:2361370-2361392 GTGGCTGCAGGTGGGAGGTGCGG + Intronic
968753994 4:2405507-2405529 GTGGCTGCCTGCAGTGGGAGCGG - Intronic
968978329 4:3833481-3833503 GTGTCTGCCTGGGGGAGGCCTGG + Intergenic
969348669 4:6585175-6585197 GGGGATGACTGTGGGAGGTGAGG - Intronic
969566147 4:7979370-7979392 GTGTTTGCCTGCGGGAGGGTGGG - Intronic
969867674 4:10086212-10086234 GTTGTTGCCTGGGGGAGCTGAGG - Intronic
973650444 4:52992776-52992798 GCGGCTGCCTGGCGGAGGGGGGG - Intronic
973956239 4:56066208-56066230 GTGGCTGCCTGGGGGTGTTACGG - Intergenic
975799769 4:78048331-78048353 CTGGCTTCCTGGGGGAGATGTGG - Intergenic
976235925 4:82896944-82896966 GTAGAAGCCTGTGGGAGGTGGGG - Intronic
976475251 4:85475613-85475635 GCGGCTGCCTGCGCCAGGGGAGG + Intronic
977958750 4:103060893-103060915 GTTGCTGGCTGGGGCAGGTGTGG - Intronic
978384939 4:108169017-108169039 TTGGCTGCCCGCTGGAGGGGAGG + Intergenic
979979490 4:127237025-127237047 GTGGCTGCAGGAGGGGGGTGAGG + Intergenic
981970796 4:150660378-150660400 GTGGCCCCGTCCGGGAGGTGAGG + Intronic
982260242 4:153488394-153488416 AGGGCTGCCTGTGGGAGGAGTGG + Intronic
983592427 4:169428548-169428570 GTGGCTGCCAGAGGTTGGTGGGG + Intronic
984742639 4:183180809-183180831 GTGGCTGCCTGGGGCGGGGGCGG + Intronic
985251149 4:188025652-188025674 GTGGCTGCCTGCTGGTAGTCTGG + Intergenic
985792142 5:1934992-1935014 GTGGCTGCCTCTGGGGGCTGGGG - Intergenic
985857696 5:2442963-2442985 GTAGCTGCCTGCGGGCAGCGAGG - Intergenic
986089197 5:4487307-4487329 GTGGATGCCTGCGTGAGTTGGGG - Intergenic
988425511 5:31058832-31058854 TTGGCTTCCTGTGGGGGGTGGGG - Intergenic
988501066 5:31784153-31784175 GTGAATGCCTGCAGGAGGTGAGG - Intronic
992893500 5:81226468-81226490 GTGGCTGGCTGAGGTGGGTGGGG + Exonic
993187283 5:84636018-84636040 TTGGCTGCCTCGGGGATGTGGGG + Intergenic
995069720 5:107905846-107905868 GTAGCTGCCTGAGGCAGCTGAGG - Intronic
996765463 5:127030781-127030803 GTGGCTGCCGGCGGGCGCTGCGG + Exonic
997212945 5:132088135-132088157 GAGGCTGCCTGCCTGAGGTTGGG + Intergenic
997453572 5:134002359-134002381 GTGCCTGCCTGTGGGTAGTGGGG - Intronic
998043192 5:138966441-138966463 GTGTCTGCCTCCAGGAGTTGAGG - Intronic
998507836 5:142686305-142686327 GTGCATCCCTGCGGGTGGTGTGG - Intronic
998778884 5:145634026-145634048 TTGGTTGCCTGTGGGAGCTGGGG - Intronic
999517126 5:152312796-152312818 GTGGTTGCCTGGGGGTGGGGTGG + Intergenic
1001560949 5:172668596-172668618 GTGGCTGGGTGTGGGAGGAGTGG + Intronic
1002798263 6:494604-494626 GTGGCTTCCTGTGGGTGGTGGGG - Intronic
1003819172 6:9876897-9876919 GTGCCAGCCTGGGGGAGGAGTGG - Intronic
1004113973 6:12749288-12749310 GGGGCTGCAGGCGGGAGGCGGGG + Intronic
1005762568 6:28980805-28980827 GTGGCTACTTGCTAGAGGTGGGG - Intergenic
1006606283 6:35259842-35259864 GTTGGTGGCTGCGGGAGGAGTGG + Intronic
1006709510 6:36054848-36054870 GCTGCTGCCTGTGGGAGGTTTGG - Intronic
1007078367 6:39082171-39082193 CTGGCTACCTGTGGGAAGTGTGG + Intronic
1008904496 6:56661480-56661502 GTGGCAGCATGCGGGGGGAGGGG + Intronic
1011722245 6:90169495-90169517 GTGGCTACCCGCAGGAAGTGGGG - Intronic
1012868964 6:104651301-104651323 GTGGCTTCCTCTGGGAAGTGAGG + Intergenic
1013048756 6:106512101-106512123 GGGGCTGGCTGCGGGCGTTGCGG - Exonic
1013116591 6:107108186-107108208 TTGGCTGCATGCGGAAGATGAGG - Intronic
1013368237 6:109450294-109450316 GGGACTGCCTGGTGGAGGTGAGG - Exonic
1013458647 6:110355819-110355841 GTGGCTTGCTGTGGTAGGTGTGG - Intronic
1013596078 6:111662263-111662285 GTGGCTGCCTGGGGGAGGGGAGG + Intronic
1013826356 6:114215540-114215562 CTGGCTTCCTGGGGGAGGGGTGG - Intronic
1017118464 6:151001595-151001617 GTGCCTGGCTGGGGGAGGTTAGG + Intronic
1017816019 6:158017258-158017280 ACGGCTGCCTGGGGGAGCTGAGG + Exonic
1018764922 6:166925542-166925564 GTGGCTGCATGATGGAGGTGAGG - Intronic
1019471545 7:1224029-1224051 GTGGCCTTCTCCGGGAGGTGGGG + Intergenic
1019519750 7:1455264-1455286 CTGACTGGCTGAGGGAGGTGAGG + Intronic
1019689671 7:2403629-2403651 GCGGCTGCGGGCGCGAGGTGAGG + Exonic
1020033617 7:4950511-4950533 GTGGCTGCCAGAGGCAGGTGAGG - Intronic
1020143912 7:5628130-5628152 GTGGCTGTCTTCGGAGGGTGAGG - Intronic
1020426250 7:8069337-8069359 GTGGCAGCTTGCTGGAGGTGTGG + Intronic
1020430941 7:8115576-8115598 GTGGCTGCCTGGGGAATGTGAGG - Intronic
1022179617 7:27906269-27906291 GTGTCTGCCTGGGGCATGTGGGG - Intronic
1022251284 7:28610934-28610956 ATGGCTGTCTGTGGGAGGAGAGG + Intronic
1022686796 7:32604476-32604498 CTGGCTGCCTGTGGGCCGTGCGG - Intergenic
1022727310 7:32992664-32992686 GGTGCTGCCTGGGGTAGGTGGGG + Intronic
1023015848 7:35968357-35968379 GCGACTGCCTGCGGGATGGGCGG - Intergenic
1023664688 7:42510586-42510608 AGGGCTGCCTGTGGGAAGTGAGG + Intergenic
1024211711 7:47211737-47211759 GTGTCTGCCTGCATGAGGTCTGG + Intergenic
1024241582 7:47440163-47440185 GCGGCATCCTGGGGGAGGTGCGG + Intronic
1025046271 7:55694985-55695007 GGTGCTGCCTGGGGTAGGTGGGG - Intergenic
1025188738 7:56881100-56881122 GCTGCTGCCTGAGTGAGGTGAGG + Intergenic
1025990336 7:66492532-66492554 GCCGCTGCCTGAGTGAGGTGAGG + Intergenic
1026038413 7:66846062-66846084 GCCGCTGCCTGAGTGAGGTGAGG - Intergenic
1026051494 7:66950937-66950959 GTGGCTGTCTGCAGGAGAAGAGG - Exonic
1026869545 7:73842102-73842124 GTGGGAGCCTGCCCGAGGTGCGG - Exonic
1027212988 7:76165524-76165546 GCCGCTGCCTGAGTGAGGTGAGG + Intergenic
1027374517 7:77537124-77537146 GCGGCTGCTGGCGGGGGGTGGGG + Intergenic
1028568490 7:92259753-92259775 GAGGAAGACTGCGGGAGGTGAGG - Intronic
1029419651 7:100466192-100466214 GTGGCTGCTTGGGGGCGGGGCGG - Intronic
1030060677 7:105618558-105618580 GTAGCTGCCTGGGGGAGAGGAGG + Intronic
1030673879 7:112365087-112365109 CTGGCAGCTTCCGGGAGGTGTGG + Intergenic
1031440150 7:121784657-121784679 GTGTCTGTCTGGGGGAGGTGGGG + Intergenic
1033502523 7:141966141-141966163 GTGGCTGCTTTCAGGGGGTGTGG + Intronic
1034225424 7:149477474-149477496 GTGGCAGCATGGGGGAGCTGTGG - Intronic
1034338916 7:150340275-150340297 GTGACTGCGTGAGGGAGGTGCGG - Intronic
1034434478 7:151056855-151056877 GTGGCCGCTTGGGGGAGGCGGGG - Intronic
1034477721 7:151296611-151296633 GTGGTTGCCTGGGGATGGTGGGG - Intergenic
1035199178 7:157249243-157249265 GTGGCTGCCTGCGGGAGGTGGGG - Intronic
1035357402 7:158284704-158284726 ATGCCTTCCTGCGGGAGGTGTGG - Intronic
1035470418 7:159105660-159105682 GGGGCTCCCTGTGTGAGGTGTGG - Intronic
1036566822 8:9945004-9945026 GTGGCTGCCCGGAGGAGGTGGGG + Intergenic
1037763497 8:21757329-21757351 ATGCCTGCCTGCTGGGGGTGGGG - Intronic
1039039991 8:33398384-33398406 GTGGATCCCAGCAGGAGGTGGGG - Intronic
1039327928 8:36505105-36505127 GTGGCTGTCATCGGGAGCTGAGG - Intergenic
1039781747 8:40792929-40792951 GTGGTTGCCTGAGGGGTGTGGGG + Intronic
1039828663 8:41195496-41195518 GGGGCTGCCAGCAGGAGGAGAGG + Intergenic
1039842277 8:41302782-41302804 GTGGGGGCCAGGGGGAGGTGGGG - Intronic
1039845755 8:41324354-41324376 TTGGCTGTCTCTGGGAGGTGGGG - Intergenic
1041783296 8:61602647-61602669 GTGGCTGCCTGGGGTTGGGGAGG + Intronic
1042533273 8:69835122-69835144 GTGGCTGGCTGTGGGAGGGCTGG - Intergenic
1043476611 8:80611559-80611581 GTTCCTCCCTGCAGGAGGTGCGG - Intergenic
1043745371 8:83868770-83868792 TTGGCTGCCTTGGGGATGTGGGG - Intergenic
1047791229 8:128205789-128205811 GGGGCTGCCTACAGGAGGTGTGG + Intergenic
1048565136 8:135588339-135588361 GTGGCTGCCTGGAGAGGGTGTGG - Intronic
1049560875 8:143309690-143309712 GTGGCGGCATGCGTGGGGTGGGG - Intronic
1049752365 8:144291372-144291394 GTGGCGGCCGGCGCGCGGTGGGG - Intergenic
1050042428 9:1510403-1510425 GGGGCTGACTGAGGGAGGTCAGG - Intergenic
1052032934 9:23648944-23648966 ATGGCTTCCAGGGGGAGGTGTGG + Intergenic
1052673083 9:31583372-31583394 GTGGAGGGCTGGGGGAGGTGGGG - Intergenic
1055757554 9:79572413-79572435 GGAGCTGCCGGCGGGCGGTGGGG + Intronic
1056796480 9:89662256-89662278 GTGGCTGCCTGCAGGAGGGCAGG - Intergenic
1057054178 9:91949080-91949102 GAGGCTGGCGGCGGGAGGGGCGG - Intronic
1057484160 9:95469057-95469079 GTGGCTGCTGTAGGGAGGTGGGG + Exonic
1057796414 9:98161159-98161181 GTGGCTGCCTGTGCTTGGTGTGG + Intronic
1058271062 9:102971882-102971904 GTGTCAGCCTGGGGGAGGGGAGG + Intergenic
1058659603 9:107256917-107256939 GTGGCCCCGTCCGGGAGGTGAGG - Intergenic
1059438497 9:114290010-114290032 GAGGCTGCCTGGTAGAGGTGTGG - Intronic
1060112445 9:120916272-120916294 GTGGTTGCCTCCTGGAGCTGTGG + Intronic
1061134057 9:128723407-128723429 GAGGCTGCCTGTGGCAGGTGAGG + Intronic
1061252900 9:129437075-129437097 GTGCGTGCCGGCGGGAGGAGGGG + Intergenic
1061386539 9:130293977-130293999 GGGGCTGCCTGCGGGAGGGGTGG + Intronic
1061693702 9:132355256-132355278 GGGGCTTCCTGCGGGTGGGGCGG + Intergenic
1061755502 9:132809453-132809475 GTGCCTGCCAGCGGGAGGATGGG - Intronic
1061974103 9:134059760-134059782 GTGGCTGCCAGCAGGCTGTGTGG - Intronic
1062194326 9:135264559-135264581 CTGCCTGCCTGCTGGAGCTGGGG - Intergenic
1062269385 9:135701697-135701719 GCCGCAGCCTGCGGGGGGTGTGG + Intergenic
1062662650 9:137646614-137646636 GGGGTGGCCTGGGGGAGGTGTGG + Intronic
1203442511 Un_GL000219v1:22593-22615 GGAGCTGCCGGCGGCAGGTGCGG + Intergenic
1203513319 Un_KI270741v1:141502-141524 GGAGCTGCCGGCGGCAGGTGCGG + Intergenic
1186189870 X:7057684-7057706 GTGGCTGTGAGCTGGAGGTGCGG + Intronic
1186334507 X:8572285-8572307 GGGCCTGCTTGGGGGAGGTGGGG - Intronic
1186393335 X:9182964-9182986 GTGGCTCTCTGCTGGAGATGAGG - Intergenic
1186519167 X:10190056-10190078 GTGGCTGCTAGAGGGAGGGGTGG + Intronic
1188707313 X:33351298-33351320 GTGGCTGCCTAGGGAAGGTGGGG + Intergenic
1189178682 X:38982825-38982847 CTGGGTGTCTGCGGGGGGTGGGG + Intergenic
1189717628 X:43882184-43882206 GTGGCTGCCTGGGGGAGACGCGG - Intronic
1190709403 X:53055598-53055620 GTGGGTGCTTGTGGGTGGTGTGG + Intronic
1192504458 X:71672512-71672534 GTAGCTGCCAGTGGGAAGTGTGG - Intergenic
1192722120 X:73710098-73710120 GGGGCTGCTTGAGGCAGGTGAGG + Intergenic
1193743783 X:85249874-85249896 GTGGCTGCCTAGGGCTGGTGGGG - Intronic
1196229320 X:113202928-113202950 GTGGCTGCCTGCTGGTGGCAGGG - Intergenic
1196781501 X:119387924-119387946 GGGGCTGCCTGCGGCACTTGCGG - Intergenic
1197870622 X:131059334-131059356 GTGGCAGCCTGAAGGGGGTGGGG - Intronic
1198703403 X:139420990-139421012 CTGGCTGCCTGTAGGAGATGAGG - Intergenic
1199009980 X:142746063-142746085 GGGGCTGCCTGCGGCACTTGCGG - Intergenic
1199267280 X:145843384-145843406 GAGGCTGCCTGGGGGAGGGGTGG + Intergenic
1200102585 X:153695317-153695339 GGGTCTGCCTGGGGGAGGAGGGG + Exonic