ID: 1035199398

View in Genome Browser
Species Human (GRCh38)
Location 7:157250834-157250856
Sequence CCTTCGGACGGTGAGTGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035199394_1035199398 1 Left 1035199394 7:157250810-157250832 CCTGATTTCTAAATGGCATAAAA 0: 1
1: 0
2: 3
3: 40
4: 373
Right 1035199398 7:157250834-157250856 CCTTCGGACGGTGAGTGTTGTGG No data
1035199392_1035199398 9 Left 1035199392 7:157250802-157250824 CCTAGTGGCCTGATTTCTAAATG 0: 1
1: 0
2: 0
3: 16
4: 206
Right 1035199398 7:157250834-157250856 CCTTCGGACGGTGAGTGTTGTGG No data
1035199391_1035199398 12 Left 1035199391 7:157250799-157250821 CCACCTAGTGGCCTGATTTCTAA 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1035199398 7:157250834-157250856 CCTTCGGACGGTGAGTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035199398 Original CRISPR CCTTCGGACGGTGAGTGTTG TGG Intronic
No off target data available for this crispr