ID: 1035199409

View in Genome Browser
Species Human (GRCh38)
Location 7:157251011-157251033
Sequence TGGGAATCTCTATGAATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035199409 Original CRISPR TGGGAATCTCTATGAATAAC TGG (reversed) Intronic
907438848 1:54465953-54465975 GGGGAACCACTATGAATAAAAGG + Intergenic
908247931 1:62242733-62242755 TGGGAATGTCTTTGGAAAACTGG - Intronic
909208042 1:72785790-72785812 TGGTAATATGTATGAATAATTGG + Intergenic
915062625 1:153198813-153198835 TGGGATTCTCTATGCAGAGCTGG + Intergenic
920998690 1:211019854-211019876 TGGGAAACTTTATGAATACTTGG + Intronic
921785186 1:219221293-219221315 GGGGAACCTCTATGAATCAGGGG + Intergenic
923217988 1:231867696-231867718 TGGGAAGATCTATCAACAACAGG - Intronic
923485661 1:234428525-234428547 GGGAAATCTGTATGAAAAACTGG - Intronic
1065133446 10:22644927-22644949 TGGGAATTTCTAGGAGTATCTGG - Intronic
1066749855 10:38643518-38643540 GGAGAATCTCCTTGAATAACAGG + Intergenic
1066966787 10:42274202-42274224 GGAGAATCTCCTTGAATAACAGG - Intergenic
1068343941 10:55746872-55746894 TGGGAATGTTTATGATTAATTGG - Intergenic
1068764543 10:60748461-60748483 TGGAAAACTCTATGACTGACTGG + Intergenic
1070096761 10:73345028-73345050 TTTGAATCTCTATAAATATCTGG + Intronic
1075183418 10:120232900-120232922 TGGAAATGTGAATGAATAACTGG + Intergenic
1075414613 10:122253168-122253190 TGGGAATCTCAAGGAAAAGCTGG + Intronic
1077255270 11:1578963-1578985 TGGGAATGTATAGGAATAATTGG - Intergenic
1083297924 11:61725252-61725274 GAGGAACCTCTGTGAATAACTGG + Intronic
1089000644 11:115049480-115049502 TGGGTATCTGTATACATAACTGG + Intergenic
1089206077 11:116763912-116763934 AGGTAATCTCTATGAAACACTGG - Intronic
1096465902 12:51847782-51847804 TGCGAATCTCTGTGTAGAACAGG + Intergenic
1096738761 12:53676714-53676736 TGGGACAGTCTAGGAATAACGGG + Intronic
1102367016 12:112346321-112346343 TGGGAATCTGCATGTTTAACAGG + Intronic
1104199892 12:126578473-126578495 TGGGAATATCTCTGACTAATAGG + Intergenic
1105240276 13:18601577-18601599 GGGGAATTTCTATGAAGAAGAGG - Intergenic
1107211555 13:37862363-37862385 TGGTAATATCTATGTATAAAAGG + Intronic
1108190456 13:47933105-47933127 TAGGAATCTGTATGCTTAACAGG + Intergenic
1111567971 13:90041710-90041732 TGGAATTCTCTGTGGATAACGGG + Intergenic
1113968685 13:114171386-114171408 TGGGACTCTTTAAGAAAAACAGG - Intergenic
1114124852 14:19713439-19713461 TGGGCATCTCTATGCCAAACTGG - Intergenic
1114401901 14:22417881-22417903 TGAGAATCTCCAGGAAGAACTGG - Intergenic
1117255751 14:53975765-53975787 TGGGAAGCTTTATGAAAAAGAGG - Intergenic
1123547454 15:21351595-21351617 GGGGAATTTCTATGAAGAAGAGG + Intergenic
1125095197 15:35842534-35842556 TGGGAATCCCTATGCTTAAGAGG - Intergenic
1126341498 15:47645766-47645788 TGGGAATCCCAATGTATAGCTGG - Intronic
1130864637 15:87922030-87922052 TGGGAATCTCATTTAATAAGTGG - Intronic
1202955784 15_KI270727v1_random:78825-78847 GGGGAATTTCTATGAAGAAGAGG + Intergenic
1133017809 16:2952674-2952696 TGGGAATGTTTATGAATACGGGG - Intergenic
1133244370 16:4438007-4438029 TTGGAATCTCAATGAAGAACAGG + Intronic
1136302188 16:29343156-29343178 TGGGTATGACTAAGAATAACAGG - Intergenic
1138650859 16:58460551-58460573 TGGGCATCTCTTGGAATATCAGG - Intergenic
1139893334 16:70268679-70268701 TGGGAATCTCTCTTACTGACAGG - Intronic
1145406825 17:22607005-22607027 TCGGAATGTTTATGATTAACTGG - Intergenic
1149557235 17:57582178-57582200 TAGCAATCTCTGTGAATAAGAGG + Intronic
1152138691 17:78523487-78523509 AGGGACTGTATATGAATAACTGG + Intronic
1154448555 18:14457197-14457219 GGGGAATTTCTATGAACAAGAGG + Intergenic
1155685837 18:28549066-28549088 TGGGAAAGTCTATGAATATGTGG + Intergenic
1164415835 19:28045913-28045935 TGAGAATAGCTATGAACAACTGG - Intergenic
1164415995 19:28046903-28046925 TGAGAATGGCTATGAATAACTGG - Intergenic
1164417311 19:28057926-28057948 TGAGAATGTCTATGAAAACCTGG + Intergenic
1164417835 19:28061070-28061092 TAAGAATCGCTATGAATACCTGG - Intergenic
1165136522 19:33673307-33673329 TGGAAATGTCAATGAGTAACTGG + Intronic
925428858 2:3773916-3773938 TGAGACTCTCTAAAAATAACTGG - Intronic
927792419 2:26020661-26020683 TGGGAAGCTCTCAGAATTACTGG + Intergenic
931701644 2:64914004-64914026 TGGGAAACCCTAAAAATAACTGG - Intergenic
932059851 2:68485300-68485322 TGGGACACTCTAGGAATAACTGG - Intronic
932627690 2:73311758-73311780 TGGGAATGATTAGGAATAACTGG - Intergenic
934312850 2:91885694-91885716 GGAGAATCTCCTTGAATAACAGG + Intergenic
934995185 2:98951041-98951063 TGGGAACCTATAGGACTAACTGG + Intergenic
939531072 2:143362447-143362469 TGGGAATCTCCACAAATAAGAGG - Intronic
939933014 2:148256541-148256563 TGGTAATCTGTATCAATAGCTGG - Intronic
940344296 2:152613389-152613411 TGAGATTCACAATGAATAACAGG - Intronic
943499787 2:188672846-188672868 TATGTATCTCTATAAATAACTGG - Intergenic
946217056 2:218192548-218192570 TGGGAACCTATATGATTAACAGG + Intergenic
947684612 2:232071871-232071893 TGGGAATGTTTTTGAATAAGAGG + Intronic
948817082 2:240517247-240517269 TGAGAACCTCTTAGAATAACTGG + Intronic
1173475195 20:43353729-43353751 TGGGGAGCCCTCTGAATAACAGG + Intergenic
1176447678 21:6833322-6833344 GGGGAATTTCTATGAACAAGAGG - Intergenic
1176825847 21:13698348-13698370 GGGGAATTTCTATGAACAAGAGG - Intergenic
1180457912 22:15528614-15528636 TGGGCATCTCTATGCCAAACTGG + Exonic
1181442986 22:22947608-22947630 TGAGAATCTCTCTAAATCACTGG + Intergenic
949841190 3:8321852-8321874 TGGGAATCTGTATTTCTAACAGG - Intergenic
951593975 3:24297245-24297267 TGCTAACCTCTTTGAATAACAGG + Exonic
952782041 3:37110823-37110845 TGGGAGTCTCTTTAAACAACGGG - Intronic
952989636 3:38820617-38820639 TAGGTATCACCATGAATAACTGG - Intergenic
956066535 3:65402610-65402632 TAGGAATCACTTTGAAAAACAGG - Intronic
958136448 3:89500417-89500439 TAGGAATCTCTATGCATAAAAGG + Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
974407308 4:61490776-61490798 GGAGAAACTCTATGAATAATGGG + Intronic
976783768 4:88792458-88792480 TGGGAACCACTATGAATAACAGG - Intronic
977700760 4:100020243-100020265 TGGGAAACTCGATGAGAAACGGG - Intergenic
980884146 4:138743767-138743789 TAGGTATCCTTATGAATAACAGG - Intergenic
984988983 4:185359671-185359693 TGGGAATTTCTTTTAATTACAGG - Intronic
987722336 5:21653967-21653989 TGTGGATTTCTTTGAATAACAGG + Intergenic
990120380 5:52443915-52443937 GGGGAATCTTTAAGAAAAACGGG - Intergenic
995849606 5:116531557-116531579 TGGGAATCACTATATCTAACAGG - Intronic
996491729 5:124105860-124105882 TGGGAATCTCTTGAAAGAACCGG + Intergenic
997015507 5:129929785-129929807 TGAAAATCTCTATGGATAAATGG + Intronic
997313155 5:132907312-132907334 TGGGAAGTTCTATGAAAAATAGG - Intronic
998244023 5:140479656-140479678 TGGGAATATACATGTATAACAGG - Intronic
999494936 5:152087479-152087501 TGGAACTCTCTATGCATGACTGG + Intergenic
1003929542 6:10910580-10910602 TGGGAATCTGGCTGAGTAACTGG + Intronic
1005044006 6:21624815-21624837 TGGGGATGACTATGAATCACTGG - Intergenic
1013167326 6:107605811-107605833 TGGGATTCTCCATGCTTAACAGG - Intronic
1016115135 6:140271963-140271985 TGGTAATCTCTATTTATAAATGG + Intergenic
1023347571 7:39287072-39287094 TGTGAGTCTCTATGAGGAACAGG + Intronic
1026285661 7:68960621-68960643 ATGGAATTTCTGTGAATAACAGG - Intergenic
1026343418 7:69453549-69453571 TGGGAATGTGTATGTTTAACTGG - Intergenic
1027737177 7:81947692-81947714 TGGAAATCAATATTAATAACAGG + Exonic
1032541964 7:132710750-132710772 TGGGTTTCTCTAGGAAGAACTGG - Intronic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1037714224 8:21383381-21383403 TGGGGATCTCTATTAAAATCAGG - Intergenic
1038365492 8:26927827-26927849 TGGGAAACTTTATGATTAATGGG + Intergenic
1040684995 8:49861084-49861106 TGGGAAGCTCTGCAAATAACTGG - Intergenic
1041814460 8:61952912-61952934 TGGGAATCTGAATGAATAAGTGG - Intergenic
1050553720 9:6771235-6771257 TGTGAATCTTTAGGAATAATTGG + Intronic
1061221888 9:129256967-129256989 CGGGAATCACTTTGAAAAACAGG + Intergenic
1062726860 9:138079122-138079144 TGGGAATCTGTATGTCTAACAGG - Intronic
1203521513 Un_GL000213v1:51209-51231 GGGGAATTTCTATGAACAAGAGG + Intergenic
1188968045 X:36579209-36579231 TGGGAAGCTCCATTATTAACAGG + Intergenic
1189623464 X:42869478-42869500 TAGGAAGATCTATGTATAACAGG + Intergenic
1195940270 X:110161941-110161963 TGAGAATTTTTATTAATAACAGG - Intronic
1198670174 X:139071685-139071707 GGAGAAATTCTATGAATAACAGG - Intronic
1200865173 Y:8035886-8035908 TGGGAACCTTTATGTATCACTGG + Intergenic