ID: 1035201238

View in Genome Browser
Species Human (GRCh38)
Location 7:157268098-157268120
Sequence TGGAGTGGCGCTGCCTGCTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 168}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035201238_1035201249 23 Left 1035201238 7:157268098-157268120 CCTGAGCAGGCAGCGCCACTCCA 0: 1
1: 0
2: 1
3: 16
4: 168
Right 1035201249 7:157268144-157268166 CGGCAGAGATACAGGGTCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 164
1035201238_1035201245 0 Left 1035201238 7:157268098-157268120 CCTGAGCAGGCAGCGCCACTCCA 0: 1
1: 0
2: 1
3: 16
4: 168
Right 1035201245 7:157268121-157268143 GGGTTCAGACAGGGCTGCACAGG 0: 1
1: 0
2: 0
3: 10
4: 209
1035201238_1035201242 -9 Left 1035201238 7:157268098-157268120 CCTGAGCAGGCAGCGCCACTCCA 0: 1
1: 0
2: 1
3: 16
4: 168
Right 1035201242 7:157268112-157268134 GCCACTCCAGGGTTCAGACAGGG 0: 1
1: 0
2: 1
3: 13
4: 139
1035201238_1035201247 15 Left 1035201238 7:157268098-157268120 CCTGAGCAGGCAGCGCCACTCCA 0: 1
1: 0
2: 1
3: 16
4: 168
Right 1035201247 7:157268136-157268158 TGCACAGGCGGCAGAGATACAGG 0: 1
1: 0
2: 1
3: 6
4: 91
1035201238_1035201241 -10 Left 1035201238 7:157268098-157268120 CCTGAGCAGGCAGCGCCACTCCA 0: 1
1: 0
2: 1
3: 16
4: 168
Right 1035201241 7:157268111-157268133 CGCCACTCCAGGGTTCAGACAGG 0: 1
1: 0
2: 0
3: 5
4: 79
1035201238_1035201248 16 Left 1035201238 7:157268098-157268120 CCTGAGCAGGCAGCGCCACTCCA 0: 1
1: 0
2: 1
3: 16
4: 168
Right 1035201248 7:157268137-157268159 GCACAGGCGGCAGAGATACAGGG 0: 1
1: 0
2: 0
3: 11
4: 149
1035201238_1035201250 24 Left 1035201238 7:157268098-157268120 CCTGAGCAGGCAGCGCCACTCCA 0: 1
1: 0
2: 1
3: 16
4: 168
Right 1035201250 7:157268145-157268167 GGCAGAGATACAGGGTCTGAGGG 0: 1
1: 0
2: 2
3: 39
4: 290
1035201238_1035201246 3 Left 1035201238 7:157268098-157268120 CCTGAGCAGGCAGCGCCACTCCA 0: 1
1: 0
2: 1
3: 16
4: 168
Right 1035201246 7:157268124-157268146 TTCAGACAGGGCTGCACAGGCGG 0: 1
1: 0
2: 0
3: 28
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035201238 Original CRISPR TGGAGTGGCGCTGCCTGCTC AGG (reversed) Exonic
900089053 1:911369-911391 GGGGGTGGGGCTCCCTGCTCAGG + Intergenic
900318304 1:2070276-2070298 TGGGGTGGGGCTGCCTGCTACGG - Intronic
900537641 1:3186816-3186838 TGGAGTGCAGCTGCCTGTTCTGG - Intronic
900648189 1:3718372-3718394 TGAAGTGGCGATCCTTGCTCTGG - Intronic
900977291 1:6025643-6025665 TGGAGTGGCAGAGCCTGCCCTGG + Intronic
901400919 1:9014725-9014747 TGGAGAGGAGCTGCCAGCGCAGG + Exonic
902245557 1:15118326-15118348 TTGAGTGATGCTGCCTGCTAAGG - Intergenic
903737980 1:25542527-25542549 TGGGGTGGCCCAGCATGCTCAGG + Intergenic
903996285 1:27307205-27307227 TGAGGTGGCGCTTCCTGCTAAGG + Exonic
904365019 1:30005110-30005132 TGGAGTGAGGCTGACTTCTCAGG - Intergenic
905067046 1:35192672-35192694 TGGTGGTGCGCTGCCTACTCCGG + Exonic
906142612 1:43542691-43542713 TGGAGTGCAGCTGCCTGATAAGG - Intronic
908138426 1:61156889-61156911 TTGTGTGGGGCTGCCTGCTGGGG + Intronic
910771093 1:90833497-90833519 TGGAGAGACACTGCCTTCTCTGG - Intergenic
913703589 1:121397079-121397101 TAGAGTGGCGCTGCCTGTGGAGG + Intergenic
913979940 1:143498790-143498812 TAGAGTGGCGCTGCCTGTGGAGG + Intergenic
914074289 1:144324274-144324296 TAGAGTGGCGCTGCCTGTGGAGG + Intergenic
914104887 1:144642172-144642194 TAGAGTGGCGCTGCCTGTGGAGG - Intergenic
915552567 1:156643886-156643908 TGGAGAGGTGTGGCCTGCTCTGG + Intronic
918423702 1:184387508-184387530 GGTCGTGGCGCTGCCTGCGCGGG + Intronic
918487728 1:185046247-185046269 TGGAGTGCCGCCTCCTGCTCTGG + Intronic
920861499 1:209711551-209711573 GGGAGTGGCGATGGCTGCACAGG + Intronic
922755858 1:228096655-228096677 TGGCGTGGCCCTGTGTGCTCTGG + Intronic
924123362 1:240824939-240824961 TGGAGTGTCTCTTCCTGCTTGGG - Intronic
924790886 1:247246831-247246853 TGGAGTTGCCCAGGCTGCTCTGG - Intergenic
1064566806 10:16647996-16648018 TGGAGTGTGGTGGCCTGCTCAGG + Intronic
1069581446 10:69569611-69569633 GAGAGTGGGGCTGACTGCTCCGG + Intergenic
1069847148 10:71380193-71380215 AGGAATGGCCCTGCCTTCTCTGG + Intergenic
1070370618 10:75778580-75778602 TGGCATGGTGCTGCCTGCTGTGG + Intronic
1072023996 10:91435571-91435593 TGGAGTGCAGCTGCCACCTCAGG + Intronic
1074884733 10:117684959-117684981 TGGGGTGGTGCTGCCTGCTGGGG - Intergenic
1075336182 10:121610231-121610253 TGGAGTCCAGCTGCCTGCTCTGG + Intergenic
1077027686 11:448519-448541 TGGACGGGAGCTGGCTGCTCTGG + Intronic
1078733044 11:13993271-13993293 GGGGGTGGGGCTACCTGCTCTGG + Intronic
1083778718 11:64907126-64907148 TGGGCTGGCGCTGCCCACTCAGG + Intronic
1083923361 11:65792090-65792112 GGGAGTGGGCCTGCCTGCTTTGG - Intronic
1084504001 11:69553849-69553871 TGGAGTGGGGGTGCCTGTGCTGG + Intergenic
1084605494 11:70169520-70169542 CCGAGAGGCGCTGCCTACTCTGG - Intronic
1084699795 11:70779023-70779045 AGCAGTGGTGGTGCCTGCTCTGG - Intronic
1084717570 11:70883533-70883555 TGGTCTGGTCCTGCCTGCTCGGG - Intronic
1084729315 11:71063184-71063206 TGGAATGGCAGTGCCTGCTGAGG - Intronic
1088599433 11:111461985-111462007 TGGAGTGGAGCTCCTGGCTCAGG - Intergenic
1089339208 11:117746170-117746192 TGGAGTGCAGCTGCATGATCTGG - Intronic
1089693917 11:120204618-120204640 TGAGGTGGCCCAGCCTGCTCTGG + Intergenic
1090667410 11:128924014-128924036 TGCAGTGCCTCTTCCTGCTCTGG - Intergenic
1091696384 12:2630822-2630844 TGGAGTAGCACAGCCTGCTGAGG + Intronic
1092209836 12:6639078-6639100 TGGAGTGCTGCTGCCTGGTGAGG - Intronic
1093435357 12:19129819-19129841 TGGAGTGGATCTCCCTGCCCCGG + Exonic
1095461712 12:42451099-42451121 AGGAGTGGTGCGGCCTGCTCAGG - Intronic
1096216571 12:49801082-49801104 AGCAGAGGGGCTGCCTGCTCAGG + Intronic
1101926124 12:108972744-108972766 TTAAGTGGCGCAGCCTGCGCTGG + Intronic
1103882363 12:124175879-124175901 TGGAGGGGCTCTGCTGGCTCAGG - Intronic
1104848248 12:131857945-131857967 TGGGGTGGTGCTGGATGCTCTGG + Intergenic
1104880196 12:132065386-132065408 TGCAGTGACGCTGCCTGCCCCGG - Intronic
1104897506 12:132171538-132171560 AGGAGTGGGGCTGCCTTCCCAGG - Intergenic
1105405376 13:20128362-20128384 TGGGGTGGCGCTGGGGGCTCGGG + Intergenic
1106430513 13:29676261-29676283 TGGAGTCTCGCTGTGTGCTCAGG - Intergenic
1110842535 13:80158829-80158851 TGGAGTGGTCCTGCCAGCCCTGG + Intergenic
1114684295 14:24513530-24513552 GGAAGTGGCACTGGCTGCTCAGG + Intergenic
1115550476 14:34500516-34500538 TGGAGAAGCGCTGCCTGCAGGGG + Intergenic
1116370194 14:44120843-44120865 TGGAGTGGTGCTGCTTGGGCCGG - Intergenic
1121010398 14:90516984-90517006 TGGCGCGACGCTGCCTGATCAGG - Intergenic
1123113117 14:105882181-105882203 TGCACTGGCTCTGCCGGCTCTGG + Intergenic
1123187060 14:106530455-106530477 TGATGTGGAGCTGCCTGCTAAGG + Intergenic
1127945391 15:63745633-63745655 AGGAGTGGCACTGCCTATTCAGG + Intronic
1128338514 15:66803582-66803604 TGGCCTAGCGCTGCCAGCTCTGG + Intergenic
1129231043 15:74197373-74197395 TGGTGAGGCGCCGCCAGCTCTGG - Exonic
1129734299 15:77951328-77951350 TGGAGAGGAGGTGCCTGCTGCGG + Intergenic
1129841286 15:78744663-78744685 TGGAGAGGAGGTGCCTGCTGCGG - Intergenic
1129854068 15:78811613-78811635 TTGCGGGGCGCTGCCTGCGCCGG - Intronic
1130738118 15:86571434-86571456 TGGAGAGGAGCTGCCTACTGTGG - Intronic
1132812745 16:1809429-1809451 TGCAGTGGCCCTGGCTCCTCCGG - Intronic
1133046273 16:3089966-3089988 TGGAGCGGCGCTGGAAGCTCTGG + Exonic
1136699261 16:32116704-32116726 TAGAGTGGCGCTGCCTGCGGAGG + Intergenic
1136768390 16:32811230-32811252 TAGAGCGGCGCTGCCTGCGGAGG - Intergenic
1136799752 16:33059875-33059897 TAGAGTGGCGCTGCCTGCGGAGG + Intergenic
1139759199 16:69170703-69170725 TGGAGTGCAGCGGCGTGCTCAGG - Intronic
1203070782 16_KI270728v1_random:1073246-1073268 TAGAGCGGCGCTGCCTGCGGAGG - Intergenic
1143301923 17:5916803-5916825 TGGAACGGGGCTGCCTGCTGGGG + Intronic
1145941147 17:28744023-28744045 TGGAGCGGCGCTCCCGGCTCCGG - Exonic
1147722479 17:42547534-42547556 TGGAGGGGCACTGCCTGCCGGGG + Intergenic
1151151147 17:72088373-72088395 TGGGGTGGCACTGCCTGACCTGG - Intergenic
1151247016 17:72802926-72802948 TGGAGTCCCTCTGCCTGCTGGGG + Intronic
1151552073 17:74828019-74828041 TGGAGTGCCGGTGCCTGAGCTGG + Intronic
1152067295 17:78118842-78118864 TGGAGTGGGGCTGGCGGCTCGGG - Intronic
1152525583 17:80886652-80886674 TGGTGTGGCCCTGGCTGCTGAGG + Intronic
1152579580 17:81160097-81160119 TGCAGAGGCCCTGCCTGCTCTGG + Intronic
1152784887 17:82242384-82242406 TGGAGAGTCCCTGCCTTCTCGGG - Intronic
1152821214 17:82438799-82438821 TGCAGAGCCGCTGCCAGCTCCGG - Intronic
1152863814 17:82710574-82710596 GGGAATGGCCGTGCCTGCTCTGG - Intergenic
1153908278 18:9683517-9683539 TGGAGTTGCGCTGCTGGTTCTGG - Intergenic
1158715946 18:59879996-59880018 TGGAGTGGAGTGGCGTGCTCTGG + Intergenic
1160955730 19:1690968-1690990 TGGAGGGGCGCTGCCTTGTGTGG - Intergenic
1161046415 19:2137168-2137190 TGGGCTGGCGCTGCCTGGTGTGG - Intronic
1162419372 19:10557521-10557543 TGCAGTGTCCCTGCCTGCCCGGG + Intronic
1163447789 19:17357725-17357747 TGGGCTGGGGCTGTCTGCTCTGG - Intronic
1163514443 19:17754600-17754622 TGGAGTGGAGCTGAGAGCTCAGG + Exonic
1165167720 19:33868937-33868959 TGCAGCGACGCTGCCTGCCCGGG + Intergenic
1165308997 19:35019354-35019376 TGGGGTGGCCCTGACTTCTCCGG + Intronic
1166838734 19:45683342-45683364 AGCAGTGGCCCTGGCTGCTCTGG - Exonic
1167798489 19:51726118-51726140 TGGCCTGGCGCAGCCTCCTCGGG - Intergenic
1202680204 1_KI270712v1_random:2681-2703 TAGAGTGGCGCTGCCTGTGGAGG - Intergenic
930544825 2:52753364-52753386 TGGAGTAGCACTGCAGGCTCAGG - Intergenic
933779512 2:85791833-85791855 TGGAGTGGGCCAGCCTCCTCGGG + Intergenic
934991361 2:98924250-98924272 TGGGCTGGAGCTGCCAGCTCGGG + Intronic
935876288 2:107511754-107511776 TGGGGTGGTGCTGCATACTCTGG - Intergenic
937365842 2:121260704-121260726 GGGAGAGGGGCAGCCTGCTCTGG - Intronic
942458156 2:176151840-176151862 TGGCTCGGCGCTGCCTGCGCGGG + Exonic
946371731 2:219285369-219285391 TCCAGTGGAGCTGCCGGCTCCGG - Exonic
947530716 2:230907175-230907197 GGGAGTGGCCCTCCCTGCTCAGG - Intergenic
947828227 2:233120720-233120742 AGGGGTGGGGCTGGCTGCTCAGG + Intronic
948017088 2:234699696-234699718 GGCACTGGCCCTGCCTGCTCAGG + Intergenic
948567791 2:238897535-238897557 AGGAGTGGCTTTTCCTGCTCAGG + Intronic
1169301581 20:4446121-4446143 TGAAGTGGCAGTGCCTTCTCTGG + Intergenic
1170665572 20:18383088-18383110 AGCAGTGGCGGTGCCTGCCCAGG + Intergenic
1172801819 20:37581359-37581381 GGGAGTGGCCATGCCTGCCCGGG + Intergenic
1172888340 20:38246577-38246599 TGGAGTGGGGCTGTCTGGTCTGG - Intronic
1173686951 20:44930627-44930649 TGGAGAGGCGCTGCATGTACTGG - Exonic
1176304535 21:5116195-5116217 TGGCCTGGCCCTGGCTGCTCAGG + Intergenic
1176408214 21:6433422-6433444 TGGTGTGGCCCTGGCTGCTATGG - Intergenic
1179683705 21:43041748-43041770 TGGTGTGGCCCTGGCTGCTATGG - Intergenic
1179852521 21:44145835-44145857 TGGCCTGGCCCTGGCTGCTCAGG - Intergenic
1179913409 21:44461713-44461735 TGGAGTGGGGCTGCCGTCTTGGG + Exonic
1180246266 21:46549923-46549945 TGGAGTGGGGGTGCCAGCTTGGG - Intronic
1180590189 22:16930748-16930770 TGGAGTGAGCCTGCCTGCCCTGG - Intergenic
1181343887 22:22203255-22203277 GGGTTTGGCGCTGCTTGCTCAGG - Intergenic
1182127665 22:27828016-27828038 GGGGCTGGGGCTGCCTGCTCTGG - Intergenic
1183431949 22:37771316-37771338 TGGAGTGGTTCAGCCTGCTCAGG + Intronic
1183739315 22:39661332-39661354 TGGACGGGCGCTTCCTGCTGGGG + Intronic
1185048955 22:48543799-48543821 TGGAGGGAAGCTGCCTGCTGGGG - Intronic
1185125748 22:49009776-49009798 AGGAGTGGTGCTGGCTCCTCAGG + Intergenic
952330766 3:32362634-32362656 TGGGCTGGCACTTCCTGCTCAGG - Intronic
952339084 3:32430319-32430341 TGTCATGGCGGTGCCTGCTCAGG + Intronic
953107300 3:39896296-39896318 TGGTGTGACCCTGTCTGCTCTGG + Intronic
954697858 3:52437014-52437036 TGGAGTCCAGCTGTCTGCTCAGG - Intronic
954856352 3:53647194-53647216 TTGACTGGCCCTGCCTACTCAGG + Intronic
956162837 3:66372930-66372952 TGGAATGGTGCTGCCCTCTCGGG + Intronic
958895479 3:99824269-99824291 CAGAGTGGCGCTTCCTGATCAGG + Intronic
959070215 3:101694985-101695007 TACTGTGGCGCTGCCTGCTGTGG - Intergenic
961448547 3:126992232-126992254 TGGAGGGGAGCTGCCTGGGCTGG + Intronic
966846604 3:184135397-184135419 TGTAGTGGCGCCGCCTGGTGTGG + Exonic
967730964 3:192906359-192906381 TGGGGTGGGGCTGCCTGCCTTGG - Intronic
967899709 3:194436845-194436867 TGCAGTGGCACTGCCGTCTCGGG - Intronic
967977568 3:195044082-195044104 TGGAGAGCAGCAGCCTGCTCTGG + Intergenic
968445646 4:650828-650850 TGGATTTTCGCTGCCGGCTCGGG - Intronic
970012953 4:11480704-11480726 TGGAGTTCAGCTGACTGCTCAGG + Intergenic
979455472 4:120922302-120922324 CTACGTGGCGCTGCCTGCTCGGG + Intronic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
980450267 4:132960105-132960127 TGGAGAGGAGCTGCCCACTCTGG + Intergenic
981074446 4:140577384-140577406 TGGATTTGCTCTGCCTCCTCAGG - Intergenic
981585760 4:146300503-146300525 TGAGGTGGCACTGCCTGCCCTGG + Intronic
985630969 5:1013799-1013821 TGGCGTGGTCCTGCCCGCTCGGG + Intronic
986339167 5:6774894-6774916 TGGTGTGGTGTTGGCTGCTCAGG + Intergenic
988987687 5:36636856-36636878 TGGAGAGGGGATTCCTGCTCTGG - Intronic
995964004 5:117882148-117882170 TGGACTGGAGCTGCCTGTACTGG - Intergenic
999371331 5:151056998-151057020 TGGACTGGCGGCGCCTACTCAGG - Intronic
1001835204 5:174825636-174825658 TGAAGTGGGGATGCCTGCTGAGG - Intergenic
1002047554 5:176550377-176550399 TGGCGGGGAGCTGCGTGCTCAGG + Intronic
1004561941 6:16760481-16760503 TGGAGTGGCGGTGACGGCCCTGG - Intronic
1007686610 6:43670828-43670850 TGGTGCTGCGCAGCCTGCTCTGG + Exonic
1011737012 6:90321190-90321212 TGAAGCAGCGCTGCCTGCTGAGG - Intergenic
1015953548 6:138577598-138577620 TGAAGTGGCCCTGCCTGGGCTGG + Intronic
1017685999 6:156914137-156914159 TGGGGTGGCGCTGGCAGTTCGGG - Intronic
1019305712 7:333295-333317 GCCAGTGGCGCTGCCGGCTCCGG - Intergenic
1021343110 7:19488931-19488953 TGGATAGGAGCTACCTGCTCTGG - Intergenic
1025014778 7:55430403-55430425 TGGATTAGTTCTGCCTGCTCTGG - Intronic
1034475140 7:151277226-151277248 TGGGGCGACGCTTCCTGCTCCGG - Intronic
1035201238 7:157268098-157268120 TGGAGTGGCGCTGCCTGCTCAGG - Exonic
1035650691 8:1261582-1261604 GGGGGTGGGGCTCCCTGCTCTGG + Intergenic
1036482415 8:9150773-9150795 TGGTGTCGCGCTGCTTGCTCCGG - Intronic
1038197394 8:25380906-25380928 TGGAATGGTGCTGCCTCCACTGG - Intronic
1045509847 8:102806149-102806171 GGGACTGGTGCTGCCTGCTTGGG - Intergenic
1051891092 9:21943911-21943933 TGGAGTGGAGGTGCCTTCCCTGG - Intronic
1054774942 9:69117260-69117282 TGGAGTGCAGCGGCCTGATCTGG + Intergenic
1058650849 9:107174642-107174664 GGGAGTGGGGCTGCCGGCACAGG + Intergenic
1062221688 9:135419438-135419460 TTGAGTTGTGCTGCCTGCTGGGG - Intergenic
1188144646 X:26596210-26596232 TGAACTGGCACTGCCTCCTCTGG - Intergenic
1190246917 X:48696857-48696879 AGGGGTGGCGTTGCCGGCTCGGG + Intronic
1190776003 X:53552718-53552740 AGGAGTGGAGCTGCCTGCTCTGG + Exonic
1193112391 X:77743042-77743064 TGGGGTGGCTCTGCCTGGTGTGG + Intronic
1196759640 X:119189942-119189964 GTGAGAGGCACTGCCTGCTCGGG - Intergenic
1197342239 X:125287826-125287848 TGGAGAGGAGCTACCTGCTGTGG + Intergenic
1198416118 X:136421462-136421484 TGGATTGCCACTGCCGGCTCGGG - Intergenic
1199418024 X:147609228-147609250 TGGAGTGTCTCAGCCTACTCTGG + Intergenic
1199745169 X:150767912-150767934 TGGCGTGGAGCTGCCTGGTTTGG - Exonic
1200883583 Y:8245817-8245839 TGCAGTGCCTCTGCCTGCTAGGG + Intergenic