ID: 1035202402

View in Genome Browser
Species Human (GRCh38)
Location 7:157276079-157276101
Sequence GAGGGGGGCGAGGGTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035202402_1035202414 -2 Left 1035202402 7:157276079-157276101 CCTGCAGCACCCTCGCCCCCCTC No data
Right 1035202414 7:157276100-157276122 TCCCCTACTCAGGGGCCCCTGGG No data
1035202402_1035202422 20 Left 1035202402 7:157276079-157276101 CCTGCAGCACCCTCGCCCCCCTC No data
Right 1035202422 7:157276122-157276144 GACCAGAGACCTCAGCCCTAGGG No data
1035202402_1035202413 -3 Left 1035202402 7:157276079-157276101 CCTGCAGCACCCTCGCCCCCCTC No data
Right 1035202413 7:157276099-157276121 CTCCCCTACTCAGGGGCCCCTGG No data
1035202402_1035202407 -10 Left 1035202402 7:157276079-157276101 CCTGCAGCACCCTCGCCCCCCTC No data
Right 1035202407 7:157276092-157276114 CGCCCCCCTCCCCTACTCAGGGG No data
1035202402_1035202421 19 Left 1035202402 7:157276079-157276101 CCTGCAGCACCCTCGCCCCCCTC No data
Right 1035202421 7:157276121-157276143 GGACCAGAGACCTCAGCCCTAGG No data
1035202402_1035202425 29 Left 1035202402 7:157276079-157276101 CCTGCAGCACCCTCGCCCCCCTC No data
Right 1035202425 7:157276131-157276153 CCTCAGCCCTAGGGACACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035202402 Original CRISPR GAGGGGGGCGAGGGTGCTGC AGG (reversed) Intergenic
No off target data available for this crispr