ID: 1035203230

View in Genome Browser
Species Human (GRCh38)
Location 7:157279647-157279669
Sequence CGGGTCCGCGGAGGGAGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035203219_1035203230 10 Left 1035203219 7:157279614-157279636 CCCTGGGGGCCTGGCGGCCGCTC No data
Right 1035203230 7:157279647-157279669 CGGGTCCGCGGAGGGAGGACCGG No data
1035203221_1035203230 1 Left 1035203221 7:157279623-157279645 CCTGGCGGCCGCTCTCCTAGAAA No data
Right 1035203230 7:157279647-157279669 CGGGTCCGCGGAGGGAGGACCGG No data
1035203224_1035203230 -7 Left 1035203224 7:157279631-157279653 CCGCTCTCCTAGAAAACGGGTCC No data
Right 1035203230 7:157279647-157279669 CGGGTCCGCGGAGGGAGGACCGG No data
1035203218_1035203230 13 Left 1035203218 7:157279611-157279633 CCACCCTGGGGGCCTGGCGGCCG No data
Right 1035203230 7:157279647-157279669 CGGGTCCGCGGAGGGAGGACCGG No data
1035203220_1035203230 9 Left 1035203220 7:157279615-157279637 CCTGGGGGCCTGGCGGCCGCTCT No data
Right 1035203230 7:157279647-157279669 CGGGTCCGCGGAGGGAGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035203230 Original CRISPR CGGGTCCGCGGAGGGAGGAC CGG Intergenic
No off target data available for this crispr