ID: 1035203959

View in Genome Browser
Species Human (GRCh38)
Location 7:157282564-157282586
Sequence CGCAGGTGGGGCTGACAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 261}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035203959_1035203966 -8 Left 1035203959 7:157282564-157282586 CCCACCTGTCAGCCCCACCTGCG 0: 1
1: 0
2: 1
3: 15
4: 261
Right 1035203966 7:157282579-157282601 CACCTGCGTGTCCCCCTGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 144
1035203959_1035203968 -4 Left 1035203959 7:157282564-157282586 CCCACCTGTCAGCCCCACCTGCG 0: 1
1: 0
2: 1
3: 15
4: 261
Right 1035203968 7:157282583-157282605 TGCGTGTCCCCCTGGAAGGCAGG 0: 1
1: 0
2: 1
3: 12
4: 151
1035203959_1035203969 -3 Left 1035203959 7:157282564-157282586 CCCACCTGTCAGCCCCACCTGCG 0: 1
1: 0
2: 1
3: 15
4: 261
Right 1035203969 7:157282584-157282606 GCGTGTCCCCCTGGAAGGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 131
1035203959_1035203976 26 Left 1035203959 7:157282564-157282586 CCCACCTGTCAGCCCCACCTGCG 0: 1
1: 0
2: 1
3: 15
4: 261
Right 1035203976 7:157282613-157282635 TCTCACCCACTCTGCACGTCAGG 0: 1
1: 0
2: 1
3: 8
4: 123
1035203959_1035203977 27 Left 1035203959 7:157282564-157282586 CCCACCTGTCAGCCCCACCTGCG 0: 1
1: 0
2: 1
3: 15
4: 261
Right 1035203977 7:157282614-157282636 CTCACCCACTCTGCACGTCAGGG 0: 1
1: 0
2: 1
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035203959 Original CRISPR CGCAGGTGGGGCTGACAGGT GGG (reversed) Intergenic
901082016 1:6588904-6588926 CGCAGGTGGGCCTGGCGGGGAGG - Exonic
901207347 1:7504592-7504614 TGCAGGTGGAGCAGGCAGGTGGG - Intronic
901449762 1:9328895-9328917 CACATGTGGGGCTCACAAGTTGG - Intronic
901811774 1:11771444-11771466 CTGGGGTGGGGCGGACAGGTTGG + Intronic
901953186 1:12764583-12764605 CTCAGGTGGGGCTGACAAGCTGG + Intergenic
902404861 1:16176998-16177020 GGCAGAAGGGGCTGAAAGGTGGG - Intergenic
902811667 1:18891468-18891490 CACAGGTGGGGTTCACTGGTCGG + Intronic
903068255 1:20713411-20713433 GGCAGGTGGGGCTGGTAGGGGGG - Intronic
904812454 1:33172338-33172360 TGCAGGTGGGGAGAACAGGTTGG + Intronic
907750782 1:57261174-57261196 CGGAGGTTGGGGTGGCAGGTGGG - Intronic
908757843 1:67485403-67485425 CAAAGCTGGGGCTGAGAGGTGGG + Intergenic
912024268 1:105147343-105147365 GACAGGTGGTGCTGACAAGTAGG + Intergenic
912978891 1:114352994-114353016 AGCAGATGGGGCTGGCAGATGGG + Intergenic
913955883 1:143292505-143292527 TGCAGGTGGGGCTCACTGGGAGG + Intergenic
913981548 1:143522932-143522954 TGCAGGTGGGGCTCACTGGGAGG - Intergenic
914075920 1:144349591-144349613 TGCAGGTGGGGCTCACTGGGAGG - Intergenic
914103258 1:144616905-144616927 TGCAGGTGGGGCTCACTGGGAGG + Intergenic
915215414 1:154337307-154337329 CACAGGCGAGGCTGACATGTAGG - Intronic
915361367 1:155288144-155288166 GGCAGGTGGGGCGGGCAGGCGGG - Exonic
920357426 1:205384919-205384941 CGCAGGTGGTGCTCACTGGAAGG - Intronic
922791842 1:228315183-228315205 CACAGGTGGCTCGGACAGGTGGG + Intronic
924607432 1:245547099-245547121 CGCAGGTGGCGCTGCCAGAAGGG + Intronic
924786495 1:247204678-247204700 CTCAGGTCAGGCTGACAGGAAGG - Intergenic
1062853025 10:759928-759950 CGCAGGTGGTACAGGCAGGTAGG - Intergenic
1065562976 10:26981888-26981910 CGCAGGAGGGGCTGACCTGTTGG + Intergenic
1066952604 10:42135922-42135944 TGCAGGTGGGGCTTACTGGGAGG + Intergenic
1070769678 10:79074906-79074928 GGCAGCTGGGCCTGACAGGCAGG - Intronic
1072724577 10:97804176-97804198 GGCAGATGGTGCTGACAGTTGGG + Intergenic
1076338967 10:129729432-129729454 CGCAGGTGAGGCTGGCAGCTCGG - Intronic
1076426822 10:130372926-130372948 CCCAGGCAGGGCTGGCAGGTTGG + Intergenic
1076470202 10:130713460-130713482 TGAAGGTGGGACTGGCAGGTTGG - Intergenic
1076482122 10:130791905-130791927 GGCAGGAGGGGCTGACGGGCGGG - Intergenic
1076625551 10:131819507-131819529 CGGAGGTGGGGCTGCCTGGTGGG - Intergenic
1076917542 10:133432167-133432189 GGCATGTTGGGCTGAGAGGTGGG - Intergenic
1076937539 10:133576242-133576264 GGCATGTTGGGCTGAGAGGTGGG - Intergenic
1078191607 11:9095961-9095983 CGCAGGAGGGGCAGGCTGGTAGG - Intronic
1078841094 11:15076047-15076069 AGCAGGTGGGGCAGGCAGGAGGG - Intronic
1079090303 11:17476216-17476238 CCCAGCTGCGGCTGACAGGGAGG + Intronic
1083540071 11:63506332-63506354 CGCAGGTGAGACTAACAGCTGGG + Intronic
1084072348 11:66744682-66744704 CGCAGGCGCGGCGGGCAGGTGGG + Intronic
1084410078 11:69001782-69001804 CACAGCTGGGGCTGACAGTATGG + Intergenic
1085313543 11:75530184-75530206 AGCAGGAGGGGCAGGCAGGTGGG - Intergenic
1085704432 11:78773508-78773530 CTCAGGTGGGGCTCACAGAAAGG + Intronic
1092272118 12:7031442-7031464 AGCAGGAGGGGCTGGCACGTTGG + Intronic
1097017340 12:55996965-55996987 CAAAAGTTGGGCTGACAGGTGGG - Intergenic
1098081624 12:66791962-66791984 CACATGTGGGGATGACTGGTAGG + Intronic
1098109561 12:67107854-67107876 CACAGCTTCGGCTGACAGGTGGG + Intergenic
1102047664 12:109839971-109839993 TGCAGGAGGGGCTGAGAGGCTGG - Intergenic
1102473425 12:113173487-113173509 CCCAGGTGTAGCTGACAGGGAGG + Intronic
1104203838 12:126617497-126617519 AGCAGGTGGGGCTAAAGGGTAGG - Intergenic
1104824115 12:131696119-131696141 CACAGGTGGGACTGATGGGTTGG - Intergenic
1104911876 12:132243670-132243692 GCCAGGTGGGGCTCACAGTTGGG - Intronic
1104969960 12:132526784-132526806 GGCAAGTGGGGCTCACAGGGAGG - Intronic
1105232594 13:18512006-18512028 TGCAGGTGGGGCTTACTGGGAGG - Intergenic
1105547961 13:21365593-21365615 GCCTGGTGGGGCTGAGAGGTGGG - Intergenic
1105614397 13:21999207-21999229 CACAGGAGGGGCTGGCAGCTGGG + Intergenic
1113340652 13:109422045-109422067 TGCAGGAAGGGCTCACAGGTGGG - Intergenic
1113632113 13:111894948-111894970 ACCAGGTGGGGGTGACAGGACGG + Intergenic
1114186263 14:20404675-20404697 CGCAGGTGGGGGCGACACGCCGG + Exonic
1115814993 14:37153847-37153869 TGCAGGTGGGGCTTGCAGATAGG - Intronic
1116486227 14:45452564-45452586 CACAGGTGGTGCTTGCAGGTAGG + Intergenic
1119206606 14:72799097-72799119 GGCAGGTGGGGCTGAATGGATGG + Intronic
1121258890 14:92552294-92552316 TGCAGGTGGGGCTGCCGGGCTGG + Intronic
1121725249 14:96142770-96142792 GGCAGGTGGGTCTCACTGGTGGG + Intergenic
1122569327 14:102683925-102683947 CCGAGGTGGGGCTGGCAGCTGGG + Intronic
1122898712 14:104773233-104773255 CGCAGGTGGGGCGCACACCTCGG + Exonic
1202938387 14_KI270725v1_random:116026-116048 TGCAGGTGGGGCTTACTGGAAGG + Intergenic
1123394807 15:19921862-19921884 TGCAGGTGGGGCTTACTGGGAGG - Intergenic
1123476975 15:20597364-20597386 GGCAGGTGGGGTTGGGAGGTCGG + Intergenic
1123641036 15:22403000-22403022 GGCAGGTGGGGTTGGGAGGTCGG - Intergenic
1124338607 15:28875664-28875686 CCCAGGAGAGGCTGACAGCTTGG + Intergenic
1126800536 15:52293655-52293677 GGCAGGTGAGGCTGAGAGGCTGG - Intronic
1128721923 15:69956434-69956456 AGCAGGAGGGGCTGGCAGGGTGG - Intergenic
1128954656 15:71927117-71927139 CAGGGGTGGGGCTGCCAGGTAGG + Intronic
1129686973 15:77691898-77691920 CGTGGGTGGGGGTGACAGATGGG - Intronic
1130245740 15:82246812-82246834 TGGAGGAGGGGATGACAGGTAGG + Intronic
1130454961 15:84096570-84096592 TGGAGGAGGGGATGACAGGTAGG - Intergenic
1131511621 15:93052258-93052280 CGCAGGCGTGGCTGCGAGGTGGG + Exonic
1132468862 16:90536-90558 AGCAGGTGGGGCTGGCAGTGAGG + Intronic
1132607121 16:798291-798313 CGGGAGTGGGGCTCACAGGTTGG + Exonic
1132607193 16:798535-798557 CGGGAGTGGGGCTCACAGGTTGG + Exonic
1132657850 16:1048746-1048768 TGCATCTGGGGCTGACGGGTGGG + Intergenic
1133338598 16:5022361-5022383 TGCAGGTGGGCCTGAGAGATTGG - Intergenic
1133402565 16:5499445-5499467 CTCAAGTGGGGCTGAAAGGACGG - Intergenic
1136373192 16:29848761-29848783 CCCAGGTGGGGGTGTCAGGTTGG + Intergenic
1136700903 16:32140278-32140300 TGCAGGTGGGGCTCACTGGGAGG - Intergenic
1136766754 16:32787180-32787202 TGCAGGTGGGGCTCACTGGGAGG + Intergenic
1136770451 16:32834868-32834890 TGCAGGTGGGGCTCACTGGGAGG + Intergenic
1136801343 16:33083198-33083220 TGCAGGTGGGGCTCACTGGGAGG - Intergenic
1136900151 16:34027118-34027140 TGCAGGTGGGGCTTACTGGGAGG - Intergenic
1136955489 16:34780204-34780226 TGCAGGTGGGGCTTACTGGGAGG - Intergenic
1136959275 16:34827006-34827028 TGCAGGTGGGGCTTACTGGGAGG - Intergenic
1136967337 16:34930017-34930039 TGCAGGTGGGGCTTACTGGGAGG - Intergenic
1137001748 16:35235251-35235273 CCCAGGTGGCCCTCACAGGTGGG + Intergenic
1137087949 16:36152130-36152152 TGCAGGTGGGGCTTACTGGGAGG - Intergenic
1137220811 16:46449276-46449298 TGCAGGTGGGGCTTACTGGCAGG + Intergenic
1137789585 16:51163853-51163875 CCCATGTGGGGCTGACAGTCTGG - Intergenic
1139340935 16:66267472-66267494 CCCAGATGGGGCTGACCGGCCGG - Intergenic
1139819414 16:69708881-69708903 GCCAGGTGAGGCTGACAAGTAGG - Intronic
1140300691 16:73754515-73754537 GGCAGCTGGGGCTGCAAGGTCGG - Intergenic
1140471451 16:75217624-75217646 GACAGGTGTGGGTGACAGGTCGG - Intergenic
1142376149 16:89708066-89708088 GGCAGGTGGGGCTGTCAGGGCGG + Intronic
1203069147 16_KI270728v1_random:1049432-1049454 TGCAGGTGGGGCTCACTGGGAGG + Intergenic
1203072872 16_KI270728v1_random:1096974-1096996 TGCAGGTGGGGCTCACTGGGAGG + Intergenic
1143247976 17:5501719-5501741 CGCAGGTGGGTCTGAGAAATGGG - Intronic
1144572399 17:16407888-16407910 GGCAGGTGGGGGTGAGGGGTAGG + Intergenic
1145691415 17:26744269-26744291 TGCAGGTGGGGCTCACTGGGAGG - Intergenic
1147120134 17:38330857-38330879 GGAAGGTGGAGCTGACAGGGGGG + Exonic
1147995245 17:44356520-44356542 TGTAGGTGGAGCTGACAGGCAGG + Exonic
1147996443 17:44362694-44362716 CGCAGGTGGGTGTGTGAGGTGGG - Intronic
1148026761 17:44594030-44594052 GGCAGATGGGGCTGACAGTGAGG + Intergenic
1148689185 17:49516966-49516988 AGCAGGGTGGGCTGAGAGGTGGG + Intergenic
1149657495 17:58318066-58318088 CCCAGGTGGGGCTTGCAGGCAGG + Intronic
1150794663 17:68227997-68228019 CGCAGCTGGGTGTGACAGGCTGG - Intergenic
1150960113 17:69903408-69903430 AGCAGGTTGTGCTGACAGATTGG - Intergenic
1151928505 17:77215801-77215823 CGTAGGTAGGGCTGGTAGGTAGG + Intronic
1152248823 17:79200876-79200898 CGCAGGAGGGGGTGAAAGGCTGG - Intronic
1152551944 17:81034592-81034614 CGCGGGCCGGGCTTACAGGTGGG - Intergenic
1152685394 17:81691340-81691362 CGAAGCTGGGCCTCACAGGTGGG - Intronic
1203182942 17_KI270729v1_random:81810-81832 TGCAGGTGGGGCTTACTGGGAGG - Intergenic
1153553201 18:6284357-6284379 CCCGGGTGGGTCTGACATGTGGG - Intronic
1153972325 18:10237866-10237888 CGGAGGTGGGGCTGGGAGCTGGG + Intergenic
1154520721 18:15226679-15226701 TGCAGGTGGGGCTTACTGGGAGG + Intergenic
1160848943 19:1180499-1180521 GGCAGGTGAGGCAGGCAGGTGGG + Intronic
1162818966 19:13211405-13211427 TGCAGGTGGGCCTGGCAGCTGGG + Intronic
1163151717 19:15418893-15418915 CACAGGTGGGCCTGGCAGGGTGG - Exonic
1163536819 19:17881742-17881764 GGCAGGTGGGACAGACAGGTGGG - Intronic
1163993355 19:21020611-21020633 CGCAGGTGAAGCGGACAGGGCGG + Exonic
1164005161 19:21141993-21142015 CGCAGCTGGAGCGGACAGGACGG + Intergenic
1164199255 19:23003198-23003220 CGCAGCTGGAGCGGACAGGGCGG - Intergenic
1164213037 19:23116984-23117006 CGCAGCTGGAGCAGACAGGGCGG + Exonic
1164880420 19:31728118-31728140 AGCAGGTGGGGCCTCCAGGTGGG + Intergenic
1165109936 19:33496470-33496492 GGCGGGTGGAGCTGCCAGGTCGG - Intronic
925367007 2:3317512-3317534 CGCATGAGGCGCTGACAGGCAGG + Intronic
925938460 2:8790776-8790798 CAGAGGTGGTGCTGGCAGGTGGG + Intronic
926693829 2:15756438-15756460 AGCAGGTGGGGCTGATGGGTGGG - Intergenic
927091874 2:19718736-19718758 CCAAGGTGGGGCTCACAGGATGG - Intergenic
927844526 2:26464654-26464676 AGCAGGTGGGGCTGCCCTGTAGG + Intronic
927970952 2:27306227-27306249 CGAAGGTGGAGCTGGCAGGGCGG + Exonic
928116527 2:28548976-28548998 CGCAGGTGGGGTGGCCAAGTGGG + Intronic
929265989 2:39920001-39920023 CACAGGTGGTGCATACAGGTGGG + Intergenic
931786466 2:65623335-65623357 TGCAGGTGGGTCTGTCAGTTTGG + Intergenic
933776563 2:85774586-85774608 CTCTGGTGGGGCTGACAGCCAGG - Intronic
933938646 2:87227330-87227352 GGAAGTTGGGGGTGACAGGTTGG - Intergenic
934259210 2:91455522-91455544 TGCAGGTGGGGCTTACTGGGAGG - Intergenic
934302509 2:91787412-91787434 TGCAGGTGGGGCTTACTGGGAGG - Intergenic
934330747 2:92065357-92065379 TGCAGGTGGGGCTTACTGGGAGG + Intergenic
934896499 2:98124384-98124406 CCCTGGTGGGGATGGCAGGTGGG + Intronic
936354489 2:111738443-111738465 GGAAGTTGGGGGTGACAGGTTGG + Intergenic
937070091 2:119056726-119056748 TGCAGGAGGGTCTGAGAGGTTGG - Intergenic
937890809 2:126937078-126937100 TGCAGGTGGGGGTGAGAAGTGGG + Intergenic
938520075 2:132060450-132060472 TGCAGGTGGGGCTTACTGGGAGG + Intergenic
940918919 2:159286649-159286671 CGCAGGTGAGGCTGGCGGGGCGG + Intronic
946027282 2:216679485-216679507 TGGAGGTGGGGCTGAGAAGTAGG + Intronic
946329578 2:219001819-219001841 CGCATCTGCGGCTGACACGTCGG + Intergenic
947735331 2:232451728-232451750 GGCAGGGGTGGCTGGCAGGTGGG - Intergenic
948214741 2:236220323-236220345 AGCAGGTGGGTGAGACAGGTGGG - Intronic
948528545 2:238588462-238588484 CGCAGGTGGGGCTGGGAGTCTGG + Intergenic
948812896 2:240494016-240494038 TGCAAGTGGTGCTGGCAGGTAGG + Intronic
1173334552 20:42102010-42102032 AGCAGGGGGGGCTGGCTGGTGGG + Intronic
1175783090 20:61696040-61696062 CGCAGGTGGGACAGACCTGTAGG - Intronic
1175880652 20:62256797-62256819 GGCAGGCGGGGCTGGCAGCTTGG + Intronic
1176048726 20:63105584-63105606 CGGAGGTGGGGTTGCCAGGCTGG - Intergenic
1176079997 20:63267696-63267718 CGCAGGTGGGGCTTTCAGGAAGG - Intronic
1176110574 20:63408854-63408876 AGCAGGTGGGGCTGGCTGGAGGG - Intronic
1176257123 20:64158461-64158483 AGCAGGTGGGGGACACAGGTGGG - Intronic
1176584928 21:8573110-8573132 TGCAGGTGGGGCTTACTGGAAGG - Intergenic
1176776571 21:13140315-13140337 TGCAGGTGGGGCTTACTGGGAGG - Intergenic
1177241230 21:18460602-18460624 TGCAGGGTGGGCTGGCAGGTGGG + Intronic
1177730704 21:25024484-25024506 TGCAGGTGGTGCATACAGGTGGG + Intergenic
1178875164 21:36408541-36408563 GGTAGGTGGAGATGACAGGTAGG + Intronic
1179209754 21:39314377-39314399 CGCAGCTGCGGCTGACGGCTCGG + Intronic
1179594935 21:42437242-42437264 CCAAGGTGGGGCTGACAAGTTGG - Intronic
1180267737 22:10550012-10550034 TGCAGGTGGGGCTTACTGGAAGG - Intergenic
1180858099 22:19060784-19060806 CCCAGGCGGGGCTCACAGGCTGG + Intronic
1180921449 22:19523555-19523577 CGCAGGCGTGGCTGGCAGGAGGG + Exonic
1180965099 22:19784029-19784051 GGCTGGTGGGGCTGGCAGCTTGG + Exonic
1181035963 22:20169834-20169856 CACAGGCAGGGCTGACAGGGCGG - Intergenic
1181043087 22:20202078-20202100 CGCAGGTGGGGCTCAGAAGCTGG - Intergenic
1181082390 22:20424047-20424069 AGCAGGCGGGGCTGGCAGGCAGG + Intergenic
1183089141 22:35509542-35509564 CGGAGGTGGGGCTGGGAGGGCGG + Intergenic
1183740165 22:39664684-39664706 CGCGGGAGGGGCGGGCAGGTGGG - Intronic
1185088168 22:48751988-48752010 GGCTGGTGGGGATGACAGGTTGG + Intronic
1185372684 22:50468324-50468346 GGCAGGTGGGGAGGGCAGGTGGG - Intronic
1203236763 22_KI270732v1_random:10298-10320 CGCAGGTGGGGCTTACTGGGAGG - Intergenic
1203323835 22_KI270737v1_random:97439-97461 TGCAGGTGGGGCTTACTGGGAGG + Intergenic
950466863 3:13160987-13161009 GGGAGCTGGGGCTGACAGGGTGG - Intergenic
952597887 3:35041448-35041470 AGCAGATGGGGTGGACAGGTAGG - Intergenic
952651870 3:35737225-35737247 CGCAGGGGCTGCTGACTGGTGGG - Exonic
960618321 3:119616070-119616092 AGAAGGTGGGGCAGCCAGGTTGG - Exonic
961556599 3:127700508-127700530 CTCACGTGGGGCAGACATGTGGG - Intronic
961647513 3:128400431-128400453 GGCAGGTGGGGCTGATATATGGG - Intronic
962164933 3:133038659-133038681 CGGAGGCAGGGCTGCCAGGTGGG - Intronic
962754953 3:138459818-138459840 GGCAGGTGGCCCTGACATGTGGG + Intronic
967053591 3:185807835-185807857 CTCAGCTGGGGCTGGAAGGTTGG - Intronic
967227061 3:187302182-187302204 AGCAGGTTGGGCTGAGAGGCTGG - Intergenic
967833050 3:193938672-193938694 CACAAGTGGGACTGAAAGGTAGG - Intergenic
968135402 3:196216645-196216667 GGCAGGCGGGGCGGGCAGGTGGG - Exonic
968910042 4:3472956-3472978 CACAGGTGTGGCTGGCAGGGCGG + Intronic
971841304 4:31855966-31855988 CAGAAGTGGGGCTGCCAGGTGGG - Intergenic
973853613 4:54987103-54987125 TGCGTGTGGTGCTGACAGGTAGG - Intergenic
974726235 4:65802218-65802240 GGCAGGTGGGGCCTACAGGAAGG + Intergenic
977262448 4:94813990-94814012 TGCAGGTGGGACTGCCAAGTAGG + Intronic
983939711 4:173526444-173526466 CGCAGGTCAGGGTGACTGGTTGG + Exonic
984675659 4:182544562-182544584 CTCAGGTGAGGATTACAGGTGGG + Intronic
985758200 5:1731589-1731611 CTGGGGTGGGGCTGACAGGACGG - Intergenic
994123622 5:96145926-96145948 CTCAGTTGGGGCTGTCAGCTGGG + Intergenic
994253378 5:97563559-97563581 CTCAGCTGGGACTGACAGTTGGG + Intergenic
997365337 5:133321845-133321867 CTCAGCAGGGGCTGCCAGGTTGG + Intronic
997471031 5:134116930-134116952 TGCAGGTGGGGCTGGCAGGCTGG + Intronic
1002048188 5:176553747-176553769 CGCTGGTGGAGGTGACAGTTGGG - Intronic
1003176114 6:3752779-3752801 GGCAGGTGGGACTGAGTGGTAGG - Intergenic
1003849426 6:10206628-10206650 CCCAGGTGGGAGTGAGAGGTGGG + Intronic
1006389700 6:33751200-33751222 CCCAGGTGGGGCTGGGAGCTAGG - Intergenic
1006806851 6:36794306-36794328 AGAGGGTGGGGCTTACAGGTGGG - Intronic
1006985279 6:38172039-38172061 GGCAGGTGAGGCTGACAGGTGGG - Exonic
1008364037 6:50654941-50654963 TGCAGGTGAGGCTGACTGGGAGG + Intergenic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1013823615 6:114184745-114184767 CCCCGGTGGGGCCGAAAGGTGGG + Intronic
1017975883 6:159356874-159356896 CACAGGTGGGTCTCCCAGGTTGG - Intergenic
1019287093 7:229051-229073 CCCCCGTGGGGCTGACAGGGAGG - Exonic
1020744783 7:12067676-12067698 AGCAGGTGGGGCTAAAAGATAGG + Intergenic
1022464532 7:30644675-30644697 TGCAGGTGGAGTTGACAGGCTGG - Intergenic
1023260753 7:38355753-38355775 CACAGCTGGGAATGACAGGTGGG + Intergenic
1023285033 7:38610001-38610023 CTCAGGTGAGGTTTACAGGTGGG - Intronic
1023326911 7:39070583-39070605 GGCTGGTGGGGCTGAGAAGTGGG - Intronic
1023843255 7:44108173-44108195 CACAGGTGGGGTTGCAAGGTGGG - Intronic
1024806173 7:53143496-53143518 TGCAGGTGGGGCTTACTGGGAGG + Intergenic
1025479873 7:60969035-60969057 TGCAGGTGGGGCTCACTGGGAGG - Intergenic
1025483451 7:61015981-61016003 TGCAGGTGGGGCTCACTGGGAGG - Intergenic
1025489045 7:61088812-61088834 CGCAGATGGGGCTTACTGGGAGG + Intergenic
1025552087 7:62263303-62263325 TGCAGGTGGGGCTCACTGGGAGG + Intergenic
1025557892 7:62332428-62332450 TGCAGGTGGGGCTCACTGGGAGG + Intergenic
1025564786 7:62420358-62420380 TGCAGGTGGGGCTCACTGGGAGG - Intergenic
1025776243 7:64563096-64563118 CGCAGCTGGAGCGGACAGGACGG - Exonic
1025788464 7:64666092-64666114 CGCAGCTGGAGCGGACAGGACGG + Intronic
1025815012 7:64903226-64903248 CGCAGCTGGAGCGGACAGGACGG + Exonic
1025886092 7:65594459-65594481 TGCAGGTGGGGCTTACTGGGAGG + Intergenic
1027250054 7:76393369-76393391 CGAAGGTGAGGCTGACAGCGGGG - Intronic
1034255285 7:149721439-149721461 GCCAGGTGGGGCTGGCTGGTAGG - Exonic
1035199114 7:157248796-157248818 CGCAGGAGGGGCTGCCGGGCAGG - Intronic
1035203959 7:157282564-157282586 CGCAGGTGGGGCTGACAGGTGGG - Intergenic
1037780837 8:21868002-21868024 GGCAGGTCAGGCTGGCAGGTGGG + Intergenic
1041804605 8:61836605-61836627 CGCAGGTGGTACTGGCGGGTAGG + Intergenic
1046780511 8:118209913-118209935 AGGAGGTTGGGCTGAAAGGTAGG - Intronic
1048321779 8:133405741-133405763 CCTGGGTGAGGCTGACAGGTGGG + Intergenic
1048572921 8:135669855-135669877 AGAAGGTGGGGCTGCCAGGTGGG + Intergenic
1049218405 8:141418014-141418036 CGCGGGTGAGCCTGGCAGGTGGG + Intronic
1049602601 8:143514893-143514915 CGCACATGGGCCTGACAGGGAGG - Intronic
1049647372 8:143741510-143741532 CACAGGTGGGGTTGGCAGGGGGG + Intergenic
1053283083 9:36834174-36834196 AGCAGCTGGGGCTGAGAAGTGGG + Exonic
1053945371 9:43303518-43303540 TGCAGGTGGGGCTTACTGGGAGG + Intergenic
1054442605 9:65280649-65280671 TGCAGGTGGGGCTTACTGGGAGG + Intergenic
1054487674 9:65740853-65740875 TGCAGGTGGGGCTTACTGGGAGG - Intergenic
1057146143 9:92760679-92760701 CACAGATGGGTCTGACAGTTGGG - Intronic
1059564408 9:115369058-115369080 TGCAGGAAGGGCTTACAGGTTGG + Intronic
1061790360 9:133055872-133055894 AGCAGGTTGGGCAGACAGGCTGG - Intronic
1061999166 9:134207416-134207438 GACAGGTGGGGAGGACAGGTGGG - Intergenic
1061999227 9:134207592-134207614 GACAGGTGGGGAGGACAGGTGGG - Intergenic
1061999292 9:134207781-134207803 GACAGGTGGGGAGGACAGGTGGG - Intergenic
1062429896 9:136522413-136522435 TGCGGGTGTGGGTGACAGGTAGG - Intronic
1062595430 9:137297008-137297030 CGGTGGAGGGGCTGGCAGGTGGG - Intergenic
1062711564 9:137977911-137977933 CGCAGGAAGGAGTGACAGGTGGG + Intronic
1203580795 Un_KI270746v1:1627-1649 TGCAGGTGGGGCTTACTGGGAGG - Intergenic
1203588506 Un_KI270747v1:32096-32118 TGCAGGTGGGGCTTACTGGGAGG + Intergenic
1203614834 Un_KI270749v1:50629-50651 TGCAGGTGGGGCTTACTGGAAGG - Intergenic
1190130651 X:47745773-47745795 TGCAGGAAGGGCTGAAAGGTTGG + Intergenic
1190286650 X:48966020-48966042 CCCAGGTGTGGCTAGCAGGTAGG + Intronic
1190687369 X:52887274-52887296 CCCAGGTGGGCCTGGCCGGTAGG - Intergenic
1190698613 X:52968518-52968540 CCCAGGTGGGCCTGGCCGGTAGG + Intronic
1190881225 X:54494246-54494268 GGCTGGAGGGGCTGATAGGTAGG - Intronic
1192171838 X:68860591-68860613 TGCAGGTGCTGCTGACAGGAGGG - Intergenic
1194469133 X:94270984-94271006 CACAGGGTGGGCTGACAGGCTGG - Intergenic
1195419971 X:104663950-104663972 CTGAGGTGGGGCTGACGGGGAGG + Intronic
1195698818 X:107686493-107686515 TGAAGGTGGGACTGACATGTTGG + Intergenic
1199693231 X:150324991-150325013 TGCAGGGTGGGCTGACAGGCTGG + Intergenic
1199817813 X:151414321-151414343 GGCAGCTGGGCCTGACACGTAGG + Intergenic
1202099806 Y:21295344-21295366 GGCAGGAGGGGCTGACAGATTGG - Intergenic