ID: 1035204951

View in Genome Browser
Species Human (GRCh38)
Location 7:157289277-157289299
Sequence CTGTGTGAACTGAGGGAAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035204951_1035204955 1 Left 1035204951 7:157289277-157289299 CCGACTTCCCTCAGTTCACACAG No data
Right 1035204955 7:157289301-157289323 CATCTCAGAGAAGCACTGGCTGG No data
1035204951_1035204957 3 Left 1035204951 7:157289277-157289299 CCGACTTCCCTCAGTTCACACAG No data
Right 1035204957 7:157289303-157289325 TCTCAGAGAAGCACTGGCTGGGG No data
1035204951_1035204954 -3 Left 1035204951 7:157289277-157289299 CCGACTTCCCTCAGTTCACACAG No data
Right 1035204954 7:157289297-157289319 CAGACATCTCAGAGAAGCACTGG No data
1035204951_1035204960 30 Left 1035204951 7:157289277-157289299 CCGACTTCCCTCAGTTCACACAG No data
Right 1035204960 7:157289330-157289352 TCCCCACGACTGCCATCCGCAGG No data
1035204951_1035204956 2 Left 1035204951 7:157289277-157289299 CCGACTTCCCTCAGTTCACACAG No data
Right 1035204956 7:157289302-157289324 ATCTCAGAGAAGCACTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035204951 Original CRISPR CTGTGTGAACTGAGGGAAGT CGG (reversed) Intergenic
No off target data available for this crispr