ID: 1035209723

View in Genome Browser
Species Human (GRCh38)
Location 7:157318850-157318872
Sequence CACCGTGCCCAGCCGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035209723_1035209734 19 Left 1035209723 7:157318850-157318872 CCATGTCCCGGCTGGGCACGGTG No data
Right 1035209734 7:157318892-157318914 GCACTTTGGGAGGCCAAGGCAGG 0: 56485
1: 171609
2: 226607
3: 184242
4: 115036
1035209723_1035209728 6 Left 1035209723 7:157318850-157318872 CCATGTCCCGGCTGGGCACGGTG No data
Right 1035209728 7:157318879-157318901 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
1035209723_1035209732 15 Left 1035209723 7:157318850-157318872 CCATGTCCCGGCTGGGCACGGTG No data
Right 1035209732 7:157318888-157318910 CCCAGCACTTTGGGAGGCCAAGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
1035209723_1035209735 22 Left 1035209723 7:157318850-157318872 CCATGTCCCGGCTGGGCACGGTG No data
Right 1035209735 7:157318895-157318917 CTTTGGGAGGCCAAGGCAGGTGG 0: 25113
1: 73031
2: 147530
3: 156446
4: 127492
1035209723_1035209730 9 Left 1035209723 7:157318850-157318872 CCATGTCCCGGCTGGGCACGGTG No data
Right 1035209730 7:157318882-157318904 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1035209723_1035209727 5 Left 1035209723 7:157318850-157318872 CCATGTCCCGGCTGGGCACGGTG No data
Right 1035209727 7:157318878-157318900 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035209723 Original CRISPR CACCGTGCCCAGCCGGGACA TGG (reversed) Intergenic
No off target data available for this crispr