ID: 1035212073

View in Genome Browser
Species Human (GRCh38)
Location 7:157336404-157336426
Sequence CCACGCGCTCCCGTTCGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035212067_1035212073 6 Left 1035212067 7:157336375-157336397 CCTTCAGTCACTATTCCCTGGCG 0: 1
1: 0
2: 0
3: 8
4: 79
Right 1035212073 7:157336404-157336426 CCACGCGCTCCCGTTCGCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1035212064_1035212073 25 Left 1035212064 7:157336356-157336378 CCACAGTTTGCTTCCGTTTCCTT 0: 1
1: 0
2: 2
3: 39
4: 446
Right 1035212073 7:157336404-157336426 CCACGCGCTCCCGTTCGCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1035212068_1035212073 -9 Left 1035212068 7:157336390-157336412 CCCTGGCGAAGTCTCCACGCGCT 0: 1
1: 0
2: 1
3: 1
4: 29
Right 1035212073 7:157336404-157336426 CCACGCGCTCCCGTTCGCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1035212065_1035212073 12 Left 1035212065 7:157336369-157336391 CCGTTTCCTTCAGTCACTATTCC 0: 1
1: 0
2: 6
3: 39
4: 381
Right 1035212073 7:157336404-157336426 CCACGCGCTCCCGTTCGCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1035212069_1035212073 -10 Left 1035212069 7:157336391-157336413 CCTGGCGAAGTCTCCACGCGCTC 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1035212073 7:157336404-157336426 CCACGCGCTCCCGTTCGCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035212073 Original CRISPR CCACGCGCTCCCGTTCGCCG GGG Intronic
900101536 1:964203-964225 CCACCCCCTCCCGTGCGCCGCGG + Intronic
901301124 1:8200672-8200694 CCACGGGCTCCCGATCACCAGGG - Intergenic
901577252 1:10210812-10210834 CCCCGCGCCCCCGCGCGCCGCGG + Exonic
903467139 1:23559496-23559518 CAACGCGCGCACGCTCGCCGCGG + Exonic
912957684 1:114166980-114167002 TCACTCCCTCCCATTCGCCGGGG + Intergenic
915934819 1:160084285-160084307 CCAGGTGCTCCAGGTCGCCGCGG - Exonic
922518188 1:226223699-226223721 CCGTGCGCTCCAGTTTGCCGAGG + Exonic
1076657830 10:132036522-132036544 CCACGCAGTCCCGGTCTCCGCGG - Intergenic
1083920776 11:65780636-65780658 CCCCGCGCTCCCGGTGGCTGCGG - Exonic
1089419799 11:118322946-118322968 CCACGCGCTGCCCTTCACCAAGG - Intergenic
1096251036 12:50032871-50032893 CCACGCGCTCCCCCGCGCCCAGG + Intronic
1097042569 12:56164489-56164511 CCACCATCTCCCGTTCGCCCCGG - Exonic
1106208824 13:27622042-27622064 CCACCCGCTCCCCTTGGGCGCGG - Intronic
1114658967 14:24332814-24332836 CCACGCCTTCCTGTTCACCGGGG - Exonic
1121560128 14:94868454-94868476 CCACCCGCTTCCATTGGCCGGGG - Intergenic
1122625704 14:103084409-103084431 CCACGCCGTCCCGTTCCCCAAGG - Intergenic
1123036916 14:105475286-105475308 CCGCGCGCTCCCGTGGGCCTGGG + Intronic
1127372741 15:58356049-58356071 CAACACGCTCCCGTTTGCTGAGG - Intronic
1128635359 15:69299107-69299129 CCACGCGCACCCGCCCTCCGCGG + Intronic
1128999515 15:72320312-72320334 TCACGCGCTCCTGCTCGCCATGG + Exonic
1129440755 15:75579302-75579324 CCACTCCCTCCCTTTCGCTGCGG - Intergenic
1151309713 17:73285729-73285751 CCAGGCTCCCCCGTACGCCGTGG - Exonic
1160824089 19:1071388-1071410 CCACGTGCTCCCGGACGCGGCGG - Intronic
1162951315 19:14073456-14073478 CCCCGCGCTCCCGCGCGCCCTGG + Exonic
1163729479 19:18940978-18941000 CCACGCCCTCCCCTTGGCCCTGG + Intronic
1165157346 19:33796503-33796525 CCGCGCGCGCCCGTTCGCGCTGG + Intronic
1167853704 19:52221163-52221185 CCACGCGCTCCAGTTCCCTAGGG - Intronic
938077308 2:128346630-128346652 CCTCGCACTCCCGGTTGCCGTGG - Intergenic
1182108016 22:27703092-27703114 CCAGGCGCTGCCGTCTGCCGAGG - Intergenic
1183607114 22:38872277-38872299 CGCCGCGCTCCCGCCCGCCGGGG - Exonic
954156110 3:48685747-48685769 CAACGCGCTGGCGTTCGCCGCGG - Exonic
960960516 3:123067398-123067420 CCAAGCGCTCCCGGACGCAGGGG + Intronic
961340314 3:126213079-126213101 CTCCGCGTTCCCGTTCGCTGCGG - Intergenic
1029537178 7:101163622-101163644 GAACGCGCTCCTGTTCGCGGAGG - Exonic
1034978016 7:155459078-155459100 CCACGCGTCCCGGCTCGCCGCGG + Intronic
1035212073 7:157336404-157336426 CCACGCGCTCCCGTTCGCCGGGG + Intronic
1060985222 9:127815780-127815802 CCACGGGCTCCCGCTTGCTGGGG + Exonic
1061504931 9:131026451-131026473 CCACGCGCTCGTCCTCGCCGGGG - Exonic
1062111618 9:134785159-134785181 CCTCGGGCTCCCGTTGGCTGTGG + Intronic
1189310651 X:40015040-40015062 CCCCGCGCTCCTCGTCGCCGCGG + Intergenic
1200244439 X:154515726-154515748 CAACTCCCTCCCGTTCGCTGTGG + Intronic