ID: 1035218961

View in Genome Browser
Species Human (GRCh38)
Location 7:157393555-157393577
Sequence TCACCCTCCTCAAGATCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035218961_1035218967 16 Left 1035218961 7:157393555-157393577 CCCTGTGATCTTGAGGAGGGTGA 0: 1
1: 0
2: 2
3: 23
4: 197
Right 1035218967 7:157393594-157393616 GCCCTGCCTACCCCAACACCAGG 0: 1
1: 0
2: 2
3: 29
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035218961 Original CRISPR TCACCCTCCTCAAGATCACA GGG (reversed) Intronic
900610308 1:3541886-3541908 CCACCCTTCTCAAGAGCAAAGGG - Intronic
901123184 1:6911347-6911369 TCATCCCCCACAAGGTCACAGGG - Intronic
901496925 1:9627659-9627681 TCAGCCACCCCAACATCACAGGG - Intergenic
902785123 1:18728128-18728150 TCACCCTCCTCCAGCCCCCAGGG - Intronic
903424823 1:23245804-23245826 TGACCTTGCTCAAGGTCACACGG - Intergenic
904856509 1:33501922-33501944 TCACCCTGCGTAAGATCAAAGGG - Intergenic
907194457 1:52675275-52675297 TCAGCCTCCACATGAGCACATGG - Intergenic
909604871 1:77498026-77498048 TCACCCTCCCTAAGTTCACTGGG - Intronic
910602249 1:89044054-89044076 TCCCACTCCTCAAGAGCACAGGG + Intergenic
911089757 1:94009147-94009169 TTACCCTCCTCCTCATCACATGG - Intronic
911585557 1:99686112-99686134 TCACCCTCCTCACTATAATATGG + Intronic
912072358 1:105827266-105827288 TCAGTCTCCTAAAGATAACAAGG - Intergenic
912716640 1:111988378-111988400 CCAGCCTCCTCAAGAGCAAAAGG + Intronic
913517670 1:119618247-119618269 TCAACCTCCTTAAAAACACAGGG + Intergenic
913940019 1:125093531-125093553 TCTCTGTCCTCAAAATCACATGG + Intergenic
914772134 1:150697156-150697178 TCAGCTTCCTCAGGATCACTAGG + Intergenic
914854505 1:151341441-151341463 TCAGCCTCCCCAAAATCACATGG - Exonic
916226220 1:162492263-162492285 TCACCCTGCTCAACATGAAAGGG + Intergenic
916584472 1:166138347-166138369 TCTTCATCCTCAATATCACAGGG + Intronic
916709353 1:167389687-167389709 TCAAGCTCCTCAAGGTCACTGGG - Exonic
917502813 1:175600770-175600792 TGACCTTCCCAAAGATCACAAGG - Intronic
917697713 1:177544136-177544158 TCAGCCTCCTGAGGATTACAAGG + Intergenic
917711564 1:177690244-177690266 TAATTCTCCCCAAGATCACATGG + Intergenic
920628266 1:207625625-207625647 TCAGTCTCCCCAAGAACACAGGG + Intronic
920638404 1:207727814-207727836 TCAGTCTCCCCAAGAACACAGGG + Intronic
922892469 1:229072492-229072514 TCACCCTCATCAAGAGAGCAGGG - Intergenic
922959113 1:229630562-229630584 TTACCATCCCCAAAATCACAGGG - Intronic
924553918 1:245102970-245102992 TCATCCTCCTCAGCCTCACAGGG - Intronic
1064382264 10:14856363-14856385 GTAGCTTCCTCAAGATCACACGG + Intronic
1064392769 10:14955790-14955812 TCCCCCTCCTCAAGATTTCATGG - Intergenic
1073782456 10:106853896-106853918 ACATTCTTCTCAAGATCACATGG - Intronic
1074227021 10:111494510-111494532 TCACCCTCCTCCAGCGCCCAGGG + Intergenic
1077996103 11:7453915-7453937 TCGCCCTCCTCAGGAGCACCAGG + Intronic
1079679015 11:23269624-23269646 ACATCCTTCTCAAGCTCACATGG + Intergenic
1080205178 11:29720601-29720623 ACATCCTTCTCAAGAACACATGG - Intergenic
1081220137 11:40449908-40449930 TCACACTCCTCATGTTCTCAGGG - Intronic
1081848474 11:46258298-46258320 TCACCCTCATCAGGGTCACCTGG - Intergenic
1084706460 11:70818916-70818938 TGACCCTCCTCAAACTCACACGG + Intronic
1086933320 11:92717453-92717475 TCACCCTCCTACAGATCAGGTGG + Intronic
1087381055 11:97405540-97405562 TCACCATCCTCAAGAACTAAGGG - Intergenic
1089001155 11:115053586-115053608 TCACACTCCCCAAGCTCACTAGG + Intergenic
1089490103 11:118877622-118877644 GCTCCCTCCACAAGACCACACGG - Intergenic
1090458593 11:126870252-126870274 ACACCCTCCTCAAGATGCCAGGG + Intronic
1091992019 12:4963049-4963071 GCAACCTGCCCAAGATCACACGG - Intergenic
1092964317 12:13626892-13626914 GCAACCTCCACAGGATCACATGG - Intronic
1096751482 12:53761576-53761598 CCACCCTCCTCAGGCCCACAAGG - Intergenic
1097697344 12:62787282-62787304 TCCCCTTCCTCTAGGTCACATGG - Intronic
1098600244 12:72323095-72323117 TCCCCTTTCCCAAGATCACAGGG - Intronic
1099736447 12:86572539-86572561 TCACCCACATCTAGCTCACATGG + Intronic
1100821346 12:98433503-98433525 TCAGCCTCCTCAACATGAAAAGG + Intergenic
1101171819 12:102105547-102105569 TCAACCTGCTAAAGATGACACGG - Intronic
1101644556 12:106618075-106618097 TCATTCTCCTCAAGTGCACATGG - Intronic
1102046283 12:109832282-109832304 TCACCCTCCTCAGGAGCCCGGGG + Intronic
1102508167 12:113397164-113397186 TCTCCCTGCCCAAGATCACCAGG - Exonic
1103003273 12:117402376-117402398 CCACCCTCCTCGAGGTCAAATGG - Intronic
1104804110 12:131574114-131574136 ACACCCTCCCCAGGATCCCAAGG + Intergenic
1107659294 13:42622829-42622851 TCACACTCCTCAAATACACATGG - Intergenic
1109508212 13:63335082-63335104 TCACCCTCCTCAGCCTCCCATGG - Intergenic
1110890108 13:80688563-80688585 CCACCATCCTCCAGATCCCAGGG - Intergenic
1111545600 13:89730809-89730831 ACATCCTTCTCAAGCTCACATGG - Intergenic
1111903559 13:94229640-94229662 TCCCCCTGCTCAATAACACAAGG + Intronic
1113319222 13:109215580-109215602 GCACCCTCCTCCTGCTCACAGGG + Intergenic
1113833009 13:113311683-113311705 CTACCCTGCTCAAGATCACAGGG - Intronic
1113970910 13:114187794-114187816 TCATTCTTCTCAAGCTCACATGG + Intergenic
1116195325 14:41717490-41717512 TAACCCTCCTCAAGTGCACAGGG - Intronic
1117961863 14:61171315-61171337 TCACCCTGCTAAAGATTGCAGGG + Intergenic
1118303544 14:64635984-64636006 TGACCATCCTCAAAATCAAAAGG + Intergenic
1119718793 14:76877195-76877217 TCACACTCCTCAAAATCAGAGGG - Intergenic
1119901063 14:78260272-78260294 TCACACTCCTGAACTTCACAGGG - Intronic
1121294921 14:92812374-92812396 TCAGCTTACTCAAGAGCACATGG + Intronic
1122510533 14:102263304-102263326 CCACTCTCCCCCAGATCACATGG + Intronic
1123162086 14:106288091-106288113 GCCCCCTCCTCAGGATTACAGGG - Intergenic
1123180127 14:106461495-106461517 GCCCCCTCCTCAGGATTACAGGG - Intergenic
1126138609 15:45417378-45417400 TATCCCACCTCCAGATCACAAGG + Exonic
1127064848 15:55226331-55226353 TCACCCTTCTCAAGAGGGCATGG + Intronic
1127145719 15:56021288-56021310 TCACCTTCGTCGAGATCAGATGG + Intergenic
1127777318 15:62275339-62275361 TAAATCTCCACAAGATCACAAGG + Intergenic
1127905590 15:63373699-63373721 TCACCCACATCAGGATCACCTGG - Intronic
1129397972 15:75263190-75263212 CAACCCTCCTCAAGCTCCCAAGG - Intronic
1129401583 15:75287471-75287493 CAACCCTCCTCAAGCTCCCAAGG - Intronic
1135677730 16:24431304-24431326 TCACCCTCCTGAAGGTCAGAAGG + Intergenic
1137289216 16:47040344-47040366 GTGACCTCCTCAAGATCACATGG + Intergenic
1138122471 16:54411637-54411659 TCACCTTCCTTATGATCTCAGGG - Intergenic
1140473191 16:75226182-75226204 TCAGAGTCCTCAAGAGCACAGGG + Intergenic
1140776466 16:78253463-78253485 GTACCCTGCTCAAGATCACTGGG + Intronic
1143020428 17:3914697-3914719 TCTCCTTCCTCACCATCACAAGG - Intronic
1144355997 17:14446915-14446937 TCAGCCTCCTCAGGACCACATGG - Intergenic
1146516778 17:33495683-33495705 CCACCCTCCTGAAGCTAACAGGG + Intronic
1148357408 17:46984668-46984690 TCCCCCTCCTCCAGATCTCAAGG + Intronic
1149982115 17:61318986-61319008 TGAGCTTGCTCAAGATCACATGG - Intronic
1150883257 17:69055712-69055734 TCATCCTTCTCATGCTCACATGG + Intronic
1151264680 17:72945682-72945704 TCCCCCTGCTCAAGAACACTAGG - Intronic
1157574538 18:48734702-48734724 TCACCCACCTCATGACCCCAGGG + Intronic
1158387715 18:57013805-57013827 TCACTCTCCTAAAGATAACGGGG + Intronic
1159256591 18:65955021-65955043 CCACCCTCCTCAGCCTCACAAGG - Intergenic
1159922681 18:74240171-74240193 TCACCCTTATTAAAATCACATGG + Intergenic
1160461242 18:79040386-79040408 AAAACCTGCTCAAGATCACATGG + Intergenic
1161022904 19:2019396-2019418 ACACCCCTCTCAAAATCACATGG - Intronic
1162112092 19:8404792-8404814 TCACCCTCGTCAGGACCCCAGGG - Intronic
1162376967 19:10310525-10310547 TCACCCTGCCCAAGATCACCAGG - Exonic
1162906482 19:13826907-13826929 CCACCCTCCTCCAGGTCCCATGG - Intronic
1165319358 19:35075961-35075983 TCACCCTCCCCAAGGACCCAGGG - Intergenic
1167064408 19:47173481-47173503 TCATCCATCTCAACATCACAGGG - Intronic
1167181522 19:47907634-47907656 TCACCCTGCGTAAGATCAAAGGG + Intergenic
1167182178 19:47913007-47913029 TCACCCTGCGTAAGATCAAAGGG + Intergenic
1167182838 19:47918385-47918407 TCACCCTGCGTAAGATCAAAGGG + Intergenic
1167183507 19:47923735-47923757 TCACCCTGCGTAAGATCAAAGGG + Intergenic
1167184803 19:47934137-47934159 TCACCCTGCGTAAGATCAAAGGG + Intergenic
1167185467 19:47939497-47939519 TCACCCTGCGTAAGATCAAAGGG + Intergenic
1167186128 19:47944878-47944900 TCACCCTGCGTAAGATCAAAGGG + Intergenic
1167186784 19:47950252-47950274 TCACCCTGCGTAAGATCAAAGGG + Intergenic
1167187436 19:47955638-47955660 TCACCCTGCGTAAGATCAAAGGG + Intergenic
1167334125 19:48874149-48874171 TCACCCTCCTCTTCATCACTGGG - Exonic
1167362379 19:49036976-49036998 TCACCCTGCGTAAGATCAAAGGG + Intergenic
1167541745 19:50092631-50092653 TCACCCTGCGTAAGATCAAAGGG - Intergenic
1167542418 19:50097968-50097990 TCACCCTGCGTAAGATCAAAGGG - Intergenic
1167542855 19:50101033-50101055 TCACCCTGCGTAAGATCAAAGGG - Intergenic
1167543291 19:50104097-50104119 TCACCCTGCGTAAGATCAAAGGG - Intergenic
1167543725 19:50107156-50107178 TCACCCTGCGTAAGATCAAAGGG - Intergenic
1167544399 19:50112510-50112532 TCACCCTGCGTAAGATCAAAGGG - Intergenic
1167545074 19:50117862-50117884 TCACCCTGCGTAAGATCAAAGGG - Intergenic
1167545751 19:50123216-50123238 TCACCCTGCGTAAGATCAAAGGG - Intergenic
1167546428 19:50128544-50128566 TCACCCTGCGTAAGATCAAAGGG - Intergenic
1167547099 19:50133886-50133908 TCACCCTGCGTAAGATCAAAGGG - Intergenic
1167547756 19:50139259-50139281 TCACCCTGCGTAAGATCAAAGGG - Intergenic
1167627955 19:50604919-50604941 TCACCCTGCGTAAGATCAAAGGG + Intergenic
927006469 2:18854910-18854932 TATCCATCCTCAAGATCACAAGG + Intergenic
929324866 2:40597009-40597031 TTAGCCTGCTCAAGATCACATGG - Intronic
930383168 2:50657761-50657783 TCACCTTCCTTTAAATCACAAGG + Intronic
933078173 2:77955048-77955070 TCACCCTGCGTAAGATCAAAGGG - Intergenic
935643100 2:105309151-105309173 TCACACTCCACAAAGTCACAGGG + Intronic
936906205 2:117537703-117537725 TGACCCTCCTCAGCATCAGAAGG - Intergenic
945188819 2:207166148-207166170 ACGCCCTCCTCGAGATCCCACGG - Intronic
946636451 2:221733560-221733582 TGACTCTCCTCAAGACCACTAGG - Intergenic
948655500 2:239474435-239474457 TCATTCTCCTCATGACCACAGGG + Intergenic
1170276767 20:14599882-14599904 CCACCCTCCTCCACATCGCATGG - Intronic
1170895032 20:20405149-20405171 TCATTCTCCTCAAGTTGACAAGG + Intronic
1172611868 20:36258495-36258517 GCAGCTTGCTCAAGATCACACGG - Intronic
1173525367 20:43728366-43728388 ACACCTTCCCCAAGGTCACATGG - Intergenic
1174269470 20:49356801-49356823 TATCCCTCCTGATGATCACATGG - Intergenic
1175771584 20:61627768-61627790 CCACCCTCCTCCACATCAAAGGG - Intronic
1176272766 20:64245029-64245051 TCACCCAGCTGAAGGTCACATGG + Intergenic
1179239581 21:39578074-39578096 TCACCCTTCCCCAGGTCACATGG - Intronic
1179927604 21:44545460-44545482 ACACTCTTCTCAAGTTCACATGG + Intronic
1179938420 21:44621099-44621121 TCACTCTCCTCAAGTTCACATGG - Intronic
1184490229 22:44804092-44804114 TCACCCTCCTCAAAGCCACATGG + Intronic
1184945376 22:47798984-47799006 ATATCCTTCTCAAGATCACATGG + Intergenic
950661030 3:14467128-14467150 TCCACCTCCCCAAGGTCACAAGG - Intronic
951025970 3:17830278-17830300 TCCCACTCCTCAATATCACTAGG - Intronic
952905801 3:38138505-38138527 TCACCCGCCTCGAGACCTCAAGG + Exonic
953099832 3:39813043-39813065 TAACCCTCTTTAAAATCACAAGG - Intronic
953470331 3:43160861-43160883 GCACCCTCTTAAAGATCATAAGG - Intergenic
954444143 3:50537619-50537641 TCTCCCTCCTCTTGAACACAAGG + Intergenic
955067188 3:55543696-55543718 TGACCCTCCTCCAGATCCTATGG - Intronic
960090178 3:113630820-113630842 TCACCCTCCTGAATCCCACAGGG + Intergenic
960411361 3:117330366-117330388 TCACACTCCTCTAGTTCACATGG - Intergenic
967185060 3:186937655-186937677 ACTCCCTCCTCAAGGTCGCACGG - Intronic
967557798 3:190878072-190878094 TCACCCTGCGTAAGATCAAAGGG - Intronic
968405563 4:336925-336947 TCTCCCTCCCCAAGCTCACCCGG - Intergenic
968447451 4:658857-658879 GCACCTTCCTCTAGCTCACACGG + Intronic
968885727 4:3330773-3330795 CCACCCTCCTCAGGAACCCAGGG + Intronic
969496632 4:7529998-7530020 TCACAGTCCTCAGGGTCACAAGG - Intronic
972203781 4:36747502-36747524 CCACCCTCCCCAAGAGCACAGGG - Intergenic
972385741 4:38563911-38563933 TCACCCTCCTCAACAGCAGATGG + Intergenic
974854542 4:67444050-67444072 ACATTCTTCTCAAGATCACATGG + Intergenic
982327023 4:154138283-154138305 TCACCATCCCTAGGATCACAGGG + Intergenic
983601824 4:169539187-169539209 TCAGCCTACTCAAGCTAACATGG - Intronic
986835264 5:11630274-11630296 ACATCCTCCTGCAGATCACAAGG - Intronic
988805899 5:34740456-34740478 TTACCCTTTTAAAGATCACAAGG - Intronic
990285557 5:54297749-54297771 TCAGCCTCATCAAGACCACCAGG + Intronic
991141592 5:63250452-63250474 TCAGCCTCCTCTAATTCACAGGG - Intergenic
993087578 5:83382437-83382459 ACATTCTCCTCAAGTTCACATGG + Intergenic
994097786 5:95862728-95862750 TCTCCCTCCTCCAGAGCACATGG + Intergenic
1000134919 5:158337909-158337931 ACACTCTTCTCAAGCTCACATGG - Intergenic
1001168848 5:169397312-169397334 TAACACTCTCCAAGATCACATGG - Intergenic
1001824368 5:174733552-174733574 ACACCCTCCCCGAAATCACAGGG + Intergenic
1002330428 5:178436987-178437009 TCCCCCTCCCTAAGATCACAAGG + Intronic
1002536429 5:179878664-179878686 GCACCCTCCCCAGGAGCACAAGG - Intronic
1003755564 6:9115843-9115865 TCTCTCTCCCCAAGATCTCAAGG - Intergenic
1006515086 6:34541271-34541293 TCCCCATCCCCAAGAGCACATGG - Intronic
1006852679 6:37110436-37110458 TCACGCTCAACAAGCTCACATGG + Intergenic
1012665446 6:101962472-101962494 ACACCCTTCTCAAGTACACATGG - Intronic
1013679349 6:112506627-112506649 ACACTCTTCTCAAGCTCACATGG - Intergenic
1014764750 6:125393519-125393541 TCAGCTGCCTCAAGAGCACAGGG + Intergenic
1017496664 6:154989617-154989639 TCTCCCTCCTGAAGATCACTTGG - Intronic
1018345009 6:162891285-162891307 TTCCCCTTCTCAAGATCACTTGG - Intronic
1019097129 6:169591357-169591379 TCACCCTCTTCAATCTCAGATGG - Intronic
1019221467 6:170476589-170476611 TCACACACCACAAGACCACAGGG - Intergenic
1026452408 7:70540765-70540787 TTACCCTTCTCAAGGTCAAAGGG - Intronic
1028972154 7:96871273-96871295 TCACCCTCCTCAAGAACTGTGGG - Intergenic
1030835024 7:114273385-114273407 TCATTCTTCTCAAGCTCACATGG - Intronic
1031887570 7:127257189-127257211 CCACCTGCCTCAAAATCACAGGG + Intergenic
1032149953 7:129419972-129419994 TCACATTCCTCAAGAGCAGAAGG - Intronic
1033280997 7:140006281-140006303 ACACCCTGCTCAAGAGCTCATGG + Intronic
1035218961 7:157393555-157393577 TCACCCTCCTCAAGATCACAGGG - Intronic
1041461857 8:58120069-58120091 ACACCTTCCTCAAGGGCACATGG + Intronic
1043135213 8:76514586-76514608 CAACTCTCCTGAAGATCACATGG - Intergenic
1045309376 8:100987223-100987245 TCACAGTCCTCAACATCAGAAGG + Intergenic
1045843100 8:106602065-106602087 TGAGCCTCTTCAAGATCACTGGG - Intronic
1046530899 8:115443614-115443636 TCAACCTGCCCAAGGTCACATGG - Intronic
1049277696 8:141728168-141728190 TCCCCCTTCTCATGAGCACAGGG + Intergenic
1050840234 9:10139747-10139769 TCACTTTCCTGAAGATCAGATGG - Intronic
1053463485 9:38288556-38288578 TCACCCTCCCCAGGCCCACAGGG + Intergenic
1055068219 9:72140311-72140333 TCTCCCTCCTCATGATCACAAGG - Intronic
1055422812 9:76161906-76161928 TCTCCCTCATCAAGACCACCTGG + Intronic
1056576657 9:87859887-87859909 ACACCCTCCACAGCATCACAGGG - Intergenic
1056886543 9:90448854-90448876 TCACCCTCTGCAAACTCACAAGG + Intergenic
1058656477 9:107226560-107226582 GCACCCTCCTCCGGTTCACATGG + Intergenic
1058886791 9:109327721-109327743 GTACCCTCCTCAAGATCACCAGG - Intergenic
1061122877 9:128654974-128654996 TCTCCCTCCTCGAGCTTACATGG - Intronic
1061700698 9:132412983-132413005 TCACCCTCCTAAAGACACCACGG - Intronic
1185724816 X:2411236-2411258 TCAGCCATCTCAAGATCAAAGGG + Intronic
1187346301 X:18467629-18467651 ACAGACTCCTCAAGTTCACAAGG - Intronic
1187736763 X:22312674-22312696 TTAACCTCCTCAAGGTCATATGG - Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189266330 X:39719606-39719628 TCAGCCTGCTCAAGATCATGTGG + Intergenic
1191972415 X:66831859-66831881 TCTCTCTCTTCAAGCTCACAGGG - Intergenic
1195573787 X:106426320-106426342 TCACCTTCCTCAAAATCTCCAGG + Intergenic
1195626308 X:107008249-107008271 AGACCCTCCTCCAGGTCACATGG + Intergenic
1196000111 X:110773825-110773847 ACATTCTTCTCAAGATCACATGG - Intronic
1197558441 X:127987710-127987732 TCCCCACCCTCAACATCACATGG - Intergenic
1199314923 X:146365659-146365681 TCACCCTCCTCTGAATCACGTGG - Intergenic
1201345376 Y:12977720-12977742 ACAATCTCCTCAAGGTCACATGG + Intergenic