ID: 1035223576

View in Genome Browser
Species Human (GRCh38)
Location 7:157421022-157421044
Sequence CCGTCCACAGAGGCAGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035223576_1035223582 16 Left 1035223576 7:157421022-157421044 CCCAAGGCTGCCTCTGTGGACGG No data
Right 1035223582 7:157421061-157421083 TTAAAGAGAAAATTCATATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035223576 Original CRISPR CCGTCCACAGAGGCAGCCTT GGG (reversed) Intergenic
No off target data available for this crispr