ID: 1035224001

View in Genome Browser
Species Human (GRCh38)
Location 7:157423781-157423803
Sequence GCTCTGTCCACAGCCAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035224001_1035224008 17 Left 1035224001 7:157423781-157423803 CCCACACTGGCTGTGGACAGAGC No data
Right 1035224008 7:157423821-157423843 TCCCTAGATTCATATTTTAGAGG No data
1035224001_1035224006 -8 Left 1035224001 7:157423781-157423803 CCCACACTGGCTGTGGACAGAGC No data
Right 1035224006 7:157423796-157423818 GACAGAGCAGGGTGCCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035224001 Original CRISPR GCTCTGTCCACAGCCAGTGT GGG (reversed) Intergenic
No off target data available for this crispr