ID: 1035224006

View in Genome Browser
Species Human (GRCh38)
Location 7:157423796-157423818
Sequence GACAGAGCAGGGTGCCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035223994_1035224006 27 Left 1035223994 7:157423746-157423768 CCTCCATCAGGTTGGTCAGGGCA No data
Right 1035224006 7:157423796-157423818 GACAGAGCAGGGTGCCTGGAAGG No data
1035223997_1035224006 1 Left 1035223997 7:157423772-157423794 CCCCTGCAGCCCACACTGGCTGT No data
Right 1035224006 7:157423796-157423818 GACAGAGCAGGGTGCCTGGAAGG No data
1035223998_1035224006 0 Left 1035223998 7:157423773-157423795 CCCTGCAGCCCACACTGGCTGTG No data
Right 1035224006 7:157423796-157423818 GACAGAGCAGGGTGCCTGGAAGG No data
1035223999_1035224006 -1 Left 1035223999 7:157423774-157423796 CCTGCAGCCCACACTGGCTGTGG No data
Right 1035224006 7:157423796-157423818 GACAGAGCAGGGTGCCTGGAAGG No data
1035223993_1035224006 28 Left 1035223993 7:157423745-157423767 CCCTCCATCAGGTTGGTCAGGGC No data
Right 1035224006 7:157423796-157423818 GACAGAGCAGGGTGCCTGGAAGG No data
1035223995_1035224006 24 Left 1035223995 7:157423749-157423771 CCATCAGGTTGGTCAGGGCAGCT No data
Right 1035224006 7:157423796-157423818 GACAGAGCAGGGTGCCTGGAAGG No data
1035224002_1035224006 -9 Left 1035224002 7:157423782-157423804 CCACACTGGCTGTGGACAGAGCA No data
Right 1035224006 7:157423796-157423818 GACAGAGCAGGGTGCCTGGAAGG No data
1035224001_1035224006 -8 Left 1035224001 7:157423781-157423803 CCCACACTGGCTGTGGACAGAGC No data
Right 1035224006 7:157423796-157423818 GACAGAGCAGGGTGCCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035224006 Original CRISPR GACAGAGCAGGGTGCCTGGA AGG Intergenic