ID: 1035224008

View in Genome Browser
Species Human (GRCh38)
Location 7:157423821-157423843
Sequence TCCCTAGATTCATATTTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035224001_1035224008 17 Left 1035224001 7:157423781-157423803 CCCACACTGGCTGTGGACAGAGC No data
Right 1035224008 7:157423821-157423843 TCCCTAGATTCATATTTTAGAGG No data
1035223998_1035224008 25 Left 1035223998 7:157423773-157423795 CCCTGCAGCCCACACTGGCTGTG No data
Right 1035224008 7:157423821-157423843 TCCCTAGATTCATATTTTAGAGG No data
1035223999_1035224008 24 Left 1035223999 7:157423774-157423796 CCTGCAGCCCACACTGGCTGTGG No data
Right 1035224008 7:157423821-157423843 TCCCTAGATTCATATTTTAGAGG No data
1035224002_1035224008 16 Left 1035224002 7:157423782-157423804 CCACACTGGCTGTGGACAGAGCA No data
Right 1035224008 7:157423821-157423843 TCCCTAGATTCATATTTTAGAGG No data
1035223997_1035224008 26 Left 1035223997 7:157423772-157423794 CCCCTGCAGCCCACACTGGCTGT No data
Right 1035224008 7:157423821-157423843 TCCCTAGATTCATATTTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035224008 Original CRISPR TCCCTAGATTCATATTTTAG AGG Intergenic