ID: 1035225976

View in Genome Browser
Species Human (GRCh38)
Location 7:157432421-157432443
Sequence GGTGTGGGTGTCCGTGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035225976_1035225985 13 Left 1035225976 7:157432421-157432443 CCAGCAACACGGACACCCACACC No data
Right 1035225985 7:157432457-157432479 GAGATCCCCAAGTCCTGTGCAGG No data
1035225976_1035225992 23 Left 1035225976 7:157432421-157432443 CCAGCAACACGGACACCCACACC No data
Right 1035225992 7:157432467-157432489 AGTCCTGTGCAGGGGAATGGTGG No data
1035225976_1035225987 15 Left 1035225976 7:157432421-157432443 CCAGCAACACGGACACCCACACC No data
Right 1035225987 7:157432459-157432481 GATCCCCAAGTCCTGTGCAGGGG No data
1035225976_1035225991 20 Left 1035225976 7:157432421-157432443 CCAGCAACACGGACACCCACACC No data
Right 1035225991 7:157432464-157432486 CCAAGTCCTGTGCAGGGGAATGG No data
1035225976_1035225986 14 Left 1035225976 7:157432421-157432443 CCAGCAACACGGACACCCACACC No data
Right 1035225986 7:157432458-157432480 AGATCCCCAAGTCCTGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035225976 Original CRISPR GGTGTGGGTGTCCGTGTTGC TGG (reversed) Intergenic