ID: 1035226048

View in Genome Browser
Species Human (GRCh38)
Location 7:157432739-157432761
Sequence GCAGCTTGTGTGCCGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035226046_1035226048 -4 Left 1035226046 7:157432720-157432742 CCACAAGCTGGGAGAAGCAGCAG No data
Right 1035226048 7:157432739-157432761 GCAGCTTGTGTGCCGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035226048 Original CRISPR GCAGCTTGTGTGCCGGAAGC TGG Intergenic
No off target data available for this crispr