ID: 1035230934

View in Genome Browser
Species Human (GRCh38)
Location 7:157465075-157465097
Sequence TGCTGGCCCATGGGAACGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035230934_1035230943 17 Left 1035230934 7:157465075-157465097 CCAGTCGTTCCCATGGGCCAGCA No data
Right 1035230943 7:157465115-157465137 TGTGTGCGCGGGCCTGAAGGCGG No data
1035230934_1035230938 -8 Left 1035230934 7:157465075-157465097 CCAGTCGTTCCCATGGGCCAGCA No data
Right 1035230938 7:157465090-157465112 GGCCAGCACAGAGGAGAAACAGG No data
1035230934_1035230941 6 Left 1035230934 7:157465075-157465097 CCAGTCGTTCCCATGGGCCAGCA No data
Right 1035230941 7:157465104-157465126 AGAAACAGGCATGTGTGCGCGGG No data
1035230934_1035230940 5 Left 1035230934 7:157465075-157465097 CCAGTCGTTCCCATGGGCCAGCA No data
Right 1035230940 7:157465103-157465125 GAGAAACAGGCATGTGTGCGCGG No data
1035230934_1035230942 14 Left 1035230934 7:157465075-157465097 CCAGTCGTTCCCATGGGCCAGCA No data
Right 1035230942 7:157465112-157465134 GCATGTGTGCGCGGGCCTGAAGG No data
1035230934_1035230944 28 Left 1035230934 7:157465075-157465097 CCAGTCGTTCCCATGGGCCAGCA No data
Right 1035230944 7:157465126-157465148 GCCTGAAGGCGGCCCCTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035230934 Original CRISPR TGCTGGCCCATGGGAACGAC TGG (reversed) Intergenic