ID: 1035230939

View in Genome Browser
Species Human (GRCh38)
Location 7:157465092-157465114
Sequence TGCCTGTTTCTCCTCTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035230939_1035230942 -3 Left 1035230939 7:157465092-157465114 CCAGCACAGAGGAGAAACAGGCA No data
Right 1035230942 7:157465112-157465134 GCATGTGTGCGCGGGCCTGAAGG No data
1035230939_1035230943 0 Left 1035230939 7:157465092-157465114 CCAGCACAGAGGAGAAACAGGCA No data
Right 1035230943 7:157465115-157465137 TGTGTGCGCGGGCCTGAAGGCGG No data
1035230939_1035230944 11 Left 1035230939 7:157465092-157465114 CCAGCACAGAGGAGAAACAGGCA No data
Right 1035230944 7:157465126-157465148 GCCTGAAGGCGGCCCCTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035230939 Original CRISPR TGCCTGTTTCTCCTCTGTGC TGG (reversed) Intergenic