ID: 1035230943

View in Genome Browser
Species Human (GRCh38)
Location 7:157465115-157465137
Sequence TGTGTGCGCGGGCCTGAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035230934_1035230943 17 Left 1035230934 7:157465075-157465097 CCAGTCGTTCCCATGGGCCAGCA No data
Right 1035230943 7:157465115-157465137 TGTGTGCGCGGGCCTGAAGGCGG No data
1035230939_1035230943 0 Left 1035230939 7:157465092-157465114 CCAGCACAGAGGAGAAACAGGCA No data
Right 1035230943 7:157465115-157465137 TGTGTGCGCGGGCCTGAAGGCGG No data
1035230937_1035230943 7 Left 1035230937 7:157465085-157465107 CCATGGGCCAGCACAGAGGAGAA No data
Right 1035230943 7:157465115-157465137 TGTGTGCGCGGGCCTGAAGGCGG No data
1035230936_1035230943 8 Left 1035230936 7:157465084-157465106 CCCATGGGCCAGCACAGAGGAGA No data
Right 1035230943 7:157465115-157465137 TGTGTGCGCGGGCCTGAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035230943 Original CRISPR TGTGTGCGCGGGCCTGAAGG CGG Intergenic