ID: 1035231202

View in Genome Browser
Species Human (GRCh38)
Location 7:157467053-157467075
Sequence CTGCCCTGCCTGCTTTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 201}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035231200_1035231202 -9 Left 1035231200 7:157467039-157467061 CCAGCGGCACAAGGCTGCCCTGC 0: 1
1: 0
2: 1
3: 14
4: 191
Right 1035231202 7:157467053-157467075 CTGCCCTGCCTGCTTTAAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 201
1035231193_1035231202 22 Left 1035231193 7:157467008-157467030 CCCTGGCTGCAGGCACTGGAGGT 0: 1
1: 1
2: 1
3: 41
4: 298
Right 1035231202 7:157467053-157467075 CTGCCCTGCCTGCTTTAAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 201
1035231194_1035231202 21 Left 1035231194 7:157467009-157467031 CCTGGCTGCAGGCACTGGAGGTC 0: 1
1: 0
2: 1
3: 28
4: 295
Right 1035231202 7:157467053-157467075 CTGCCCTGCCTGCTTTAAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 201
1035231197_1035231202 -1 Left 1035231197 7:157467031-157467053 CCTGCCACCCAGCGGCACAAGGC 0: 1
1: 0
2: 0
3: 14
4: 192
Right 1035231202 7:157467053-157467075 CTGCCCTGCCTGCTTTAAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 201
1035231198_1035231202 -5 Left 1035231198 7:157467035-157467057 CCACCCAGCGGCACAAGGCTGCC 0: 1
1: 0
2: 1
3: 13
4: 174
Right 1035231202 7:157467053-157467075 CTGCCCTGCCTGCTTTAAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 201
1035231191_1035231202 23 Left 1035231191 7:157467007-157467029 CCCCTGGCTGCAGGCACTGGAGG 0: 1
1: 0
2: 5
3: 25
4: 383
Right 1035231202 7:157467053-157467075 CTGCCCTGCCTGCTTTAAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 201
1035231199_1035231202 -8 Left 1035231199 7:157467038-157467060 CCCAGCGGCACAAGGCTGCCCTG 0: 1
1: 0
2: 0
3: 14
4: 181
Right 1035231202 7:157467053-157467075 CTGCCCTGCCTGCTTTAAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035231202 Original CRISPR CTGCCCTGCCTGCTTTAAGG AGG Intergenic
900313801 1:2047457-2047479 CTGCCCTGCCTGCCCAGAGGCGG + Intergenic
900485134 1:2919181-2919203 CTGCCCCGCCTGCGTGATGGGGG - Intergenic
900641466 1:3689855-3689877 ATGCCCTGCCTGCTTCCAGGGGG + Intronic
900866018 1:5269219-5269241 CTGCCCTGTCAGCTTTGAAGTGG + Intergenic
901273355 1:7971051-7971073 ATGCCCTGCATGCTTTATGAAGG - Intronic
901592987 1:10361673-10361695 CTACCCTGTCTGCTTTCAGCTGG + Exonic
903378838 1:22883276-22883298 CTGCCCTGCCTGCTGCACAGTGG + Intronic
904339509 1:29825016-29825038 CTTCCCTGCCTGGCTCAAGGAGG + Intergenic
904983147 1:34523601-34523623 AAGCTCAGCCTGCTTTAAGGAGG - Intergenic
907441210 1:54479632-54479654 CTGCCCTGCCAGCTATAGGGAGG - Intergenic
907574340 1:55512689-55512711 CTGCCCTGGCTACTGTGAGGTGG + Intergenic
908153094 1:61324695-61324717 CTCTCCTGCCTGCTAAAAGGCGG + Intronic
909686388 1:78353971-78353993 CTGCCATTGCTGCTTGAAGGTGG - Intronic
909803356 1:79843514-79843536 TTGCCCTGCCTGCATGAAAGGGG + Intergenic
915332775 1:155124045-155124067 CTGCCCTGCCAGCTTTTTGCTGG - Intergenic
917646554 1:177034287-177034309 CTGTGCTGCCTGCTTGAAAGTGG - Intronic
917663017 1:177196282-177196304 CTGCACTGACTCGTTTAAGGAGG + Intronic
919753298 1:201051799-201051821 CTGCACTGCCTGCTCTAGGAAGG - Intronic
920271494 1:204768215-204768237 CTTTCCTGCCTGCTTTAAGCCGG + Intergenic
920877710 1:209852671-209852693 CAGCCCTGCTTGCTTTTAGTAGG + Exonic
922670932 1:227508305-227508327 CTGCCCTTTCTGGTTAAAGGGGG + Intergenic
922779380 1:228239861-228239883 CTGCCCTGCCTGGTCCAGGGAGG + Intronic
923024273 1:230192095-230192117 CTGCCCAGCCCCCTTTCAGGTGG - Intronic
923104381 1:230843265-230843287 GTGGCCTGCCTGCTTTGTGGGGG + Intronic
924586828 1:245367526-245367548 CGGGCCTGCCTGCTTTGAGAGGG + Intronic
1063535127 10:6876054-6876076 CTGCCCTGCCTGCCCTGAGGAGG + Intergenic
1066004352 10:31133541-31133563 GTGCCTTGCCTGCTTTATGTGGG - Intergenic
1066279465 10:33901184-33901206 CTGCCATGGCAGCTTTGAGGTGG + Intergenic
1067945546 10:50686093-50686115 AGGCCCTGCCTGCTTTAGGGAGG + Intergenic
1069933969 10:71902444-71902466 CTGCCCTACCAGCTTTAGGTGGG - Intergenic
1070867057 10:79712966-79712988 AGGCCCTGCCTGCTTTAGGGAGG + Intronic
1070880847 10:79851087-79851109 AGGCCCTGCCTGCTTTAGGGAGG + Intergenic
1071633971 10:87235189-87235211 AGGCCCTGCCTGCTTTAGGGAGG + Intronic
1071647419 10:87367406-87367428 AGGCCCTGCCTGCTTTAGGGAGG + Intronic
1071861438 10:89677426-89677448 CTGCTCTGCCATCTTTAATGTGG + Intergenic
1072468982 10:95694100-95694122 CGGCCCGGCCCGCGTTAAGGAGG - Exonic
1073687463 10:105770987-105771009 CAGCCCTGCATGCTTAGAGGTGG + Intergenic
1078827307 11:14941526-14941548 CTGGCCTGACTGATGTAAGGTGG - Intronic
1083305211 11:61758378-61758400 CTGCCCTGCTAGCTTGGAGGAGG + Intronic
1083369032 11:62163877-62163899 CTACCCTGCATGCTGGAAGGAGG + Intergenic
1087393237 11:97566269-97566291 CTGGCCTCCATGATTTAAGGTGG - Intergenic
1087966828 11:104425182-104425204 GTGCCTTTCCTGCTTTGAGGTGG - Intergenic
1088114893 11:106302762-106302784 CTGACCTCCCTGCTTTGAGGTGG + Intergenic
1088431954 11:109768486-109768508 CTGACCCCCTTGCTTTAAGGTGG + Intergenic
1089739495 11:120572529-120572551 TTGCCTGGCCTGCTTTAAGGAGG + Intronic
1089931300 11:122315955-122315977 CTTCTCTGGTTGCTTTAAGGTGG - Intergenic
1090681159 11:129058650-129058672 CTGCCCTGATTGGTTTAAGTGGG - Intronic
1090997897 11:131883814-131883836 CTGCCCTTTCTACTTTTAGGGGG - Intronic
1091678265 12:2507313-2507335 CTCCCCTTTCTGGTTTAAGGAGG + Intronic
1095755308 12:45758747-45758769 CTGCCCTGCTAGCTGGAAGGAGG - Intronic
1096123917 12:49106053-49106075 CAGCTCTGCCTTCTTTGAGGGGG - Intronic
1096570917 12:52522700-52522722 CTGCCCTGCCTGCTCATGGGAGG - Intergenic
1100455013 12:94743211-94743233 CTGCCCTGCCTGCCTCACAGGGG - Intergenic
1101601467 12:106213708-106213730 CTGCACTGCCAGCTCTGAGGGGG + Intergenic
1101633731 12:106520195-106520217 CTGCCCTGCCTTTTTAAATGGGG + Intronic
1101876476 12:108599625-108599647 CAGCTGTGCCCGCTTTAAGGTGG + Intergenic
1102173279 12:110858364-110858386 CTGCCCTGCCTTCTCTGAGGTGG - Intronic
1103901440 12:124305635-124305657 CTGCACTGCCGGCTTTGATGAGG - Intronic
1106229656 13:27812097-27812119 TTGCCCAGGCTGCTCTAAGGAGG + Intergenic
1108118662 13:47160035-47160057 CCGCCCTGCCAGCTTGAAAGGGG - Intergenic
1110612416 13:77503695-77503717 TTGCCCTACCTGCTTCAAGCTGG + Intergenic
1112296029 13:98188089-98188111 CAGCCCTGCCTGCTTGAACATGG + Intronic
1112489311 13:99847787-99847809 CAGCCCTGCCTGCCTTCGGGAGG - Intronic
1114980512 14:28158171-28158193 AGGCCCTCCCTGCTTGAAGGTGG + Intergenic
1119545670 14:75469734-75469756 CTGTCCTGCCTCCTTCAAGTGGG - Exonic
1121340836 14:93104073-93104095 CTGCCCTCCCAACTGTAAGGTGG - Intronic
1121685291 14:95831130-95831152 CTGCTCTGCCTGCTTGCTGGTGG + Intergenic
1122408714 14:101515074-101515096 CTGCCGTGCCTGCTTTACAGAGG - Intergenic
1122909636 14:104821119-104821141 CTTCCCTGCCACCTCTAAGGAGG - Intergenic
1128756020 15:70184567-70184589 CTGCCCTGCCTGATGTAGGTGGG - Intergenic
1130416699 15:83701259-83701281 CTGCCTTGATTGCTTCAAGGAGG - Intronic
1131392224 15:92058804-92058826 CTGCCCCGCCTGCCTTCTGGTGG + Intronic
1132288873 15:100685571-100685593 CTGCCCAGGCTGCTGTGAGGGGG - Intergenic
1134227067 16:12399494-12399516 CAGCCCTGCCTGCTCTAAAAGGG - Intronic
1136118545 16:28112456-28112478 CTGCCCTCCCTCCTGTTAGGTGG + Intronic
1139978274 16:70832760-70832782 CAGGCCTGCCTGTTTGAAGGAGG + Intronic
1140456090 16:75106421-75106443 CTGCCCAGGCTGCTTTGAAGGGG - Intronic
1141124199 16:81388556-81388578 CTGCCCTCCCGGCTTGGAGGGGG - Exonic
1141137722 16:81477539-81477561 CTGCCCTCCCTGTGTGAAGGCGG + Intronic
1142904442 17:3032901-3032923 TTCCCCTGCCTGCTTTGAGGGGG + Intronic
1145295983 17:21593015-21593037 CTGCCGTGCCTCATTTAACGGGG + Intergenic
1150640247 17:66944825-66944847 TTGCCCAGCCAGCTTTAGGGAGG + Intergenic
1152162385 17:78676968-78676990 GTGCCCTGCCTGCAGTCAGGAGG - Intronic
1152844372 17:82590924-82590946 CTGGGCTGCCTGCCCTAAGGGGG + Intronic
1154025800 18:10706095-10706117 CTGCTCTGTCTGCTTCAAGGAGG + Intronic
1155043507 18:22084558-22084580 ATGCCTTGCCAGCTTTCAGGAGG + Intergenic
1155333622 18:24742931-24742953 GTGCACTCTCTGCTTTAAGGAGG - Intergenic
1156212428 18:34959640-34959662 GTGCCTTGCCTACTTTAAGGTGG - Intergenic
1156997445 18:43484968-43484990 CTGCCCTGCCACCTTGGAGGTGG + Intergenic
1157158309 18:45288893-45288915 ATGCTCTGACTGCATTAAGGCGG - Intronic
1157475715 18:48022229-48022251 CCGCCCTGCCCTCTTTGAGGTGG - Intergenic
1158606505 18:58900749-58900771 CTGACCTGTGTGCTTTAAAGAGG - Intronic
1160477059 18:79200911-79200933 TTGCCCTGGCTGCTTTAGGACGG + Intronic
1160846265 19:1167540-1167562 TTGCCCTGCTGGCTTTTAGGAGG - Intronic
1161767492 19:6215575-6215597 CTGCCCAGCTTGCGTGAAGGTGG + Intronic
1161812783 19:6479987-6480009 CTGCCCTGCCTCCCTGCAGGAGG - Exonic
1162048727 19:8019007-8019029 CTGCACTGCTGGCTTGAAGGTGG + Intronic
1162918966 19:13889320-13889342 CTGCCCTGCCAGCTCTGAGGTGG + Exonic
1163560984 19:18019308-18019330 CTGCTCTGCCTACTTTGATGTGG + Intergenic
1165660816 19:37578755-37578777 CTGCCCTACCTCCTCTGAGGCGG + Intronic
1167034443 19:46985894-46985916 CTGGCCTGCCTGTTTTCTGGGGG - Intronic
925058771 2:875212-875234 CAGCCCTGCCTACTCTAAGTTGG - Intergenic
926819624 2:16838326-16838348 CTGCCCTGGGTGTTTCAAGGAGG - Intergenic
927506309 2:23617189-23617211 GTGCCCTGCCTGGCTGAAGGAGG - Intronic
927883863 2:26706732-26706754 GTCCCCTGCCTGCTTCCAGGGGG + Intronic
931235493 2:60409379-60409401 CTGCCCTGCCTGCCCTAAACCGG - Intergenic
932813508 2:74843650-74843672 CTGCCCTGGATGCTTGGAGGTGG + Intronic
934207302 2:89942556-89942578 ATGCCCTGACTGCTTCTAGGAGG + Intergenic
935654235 2:105408213-105408235 CAACCCTACCTGTTTTAAGGTGG + Intronic
936054067 2:109247499-109247521 CACCCATGCCTGCCTTAAGGTGG - Intronic
937839636 2:126512471-126512493 ATGCCCTGCCTGCATTTAGAAGG + Intergenic
942251791 2:174053645-174053667 GTGCCCCGCCTGCTTCAATGGGG - Intergenic
942424590 2:175846278-175846300 CTGCCCTGCCTCCTGTCATGTGG + Intergenic
945021721 2:205579650-205579672 CAACCTTGCCTGATTTAAGGTGG + Intronic
945968033 2:216209272-216209294 TTCCCCTGCCTGCTATAGGGAGG - Intergenic
946476545 2:220011640-220011662 CTGACCAGCCTGCTTCAAGTTGG - Intergenic
946933575 2:224696244-224696266 ATGCACTTCCTGCTTTAAGATGG + Intergenic
946959954 2:224974004-224974026 CTTCCCTGACTGATTTGAGGAGG + Intronic
947441907 2:230130889-230130911 CCTTCCTGCCTGCTTTGAGGAGG + Intergenic
948396472 2:237648804-237648826 CATCACTGCCTGCTTTGAGGGGG - Intronic
948598253 2:239094248-239094270 CTGCCCAGGCTGCATCAAGGAGG + Intronic
1170153198 20:13246575-13246597 CTGCTCTGCCTCCTTAAATGTGG - Intronic
1170495874 20:16924781-16924803 CTGCCCTGTCTACTTTAAGGTGG + Intergenic
1170596777 20:17811443-17811465 CTGCGCTCCCTGGTTTCAGGAGG - Intergenic
1172356767 20:34285631-34285653 TTGCCCTGCCTGCGTGTAGGTGG - Exonic
1173501746 20:43558952-43558974 CAGCCCTGCCTGCTGGAAGCTGG - Intronic
1174397494 20:50256892-50256914 CTGCCCGGGCTTCTTGAAGGAGG + Intergenic
1175190862 20:57211371-57211393 CTGCCCTGCCTCCTCTAACTTGG - Intronic
1175822793 20:61919506-61919528 CTGGCCTGCCTGCCTGCAGGTGG + Intronic
1176269537 20:64228688-64228710 CTGCACTGCCCACTTTTAGGTGG + Intronic
1177145828 21:17406166-17406188 CAGGCCTGACTGCTTTAAGTTGG + Intergenic
1178209613 21:30514505-30514527 CTTCCCTGCCTGCTATGAGCGGG + Intergenic
1181552771 22:23650119-23650141 CTGCCCTACCTACTTGAATGAGG - Intergenic
1181667596 22:24408947-24408969 CTGCCCAGCCTGCTTTACTTGGG + Intronic
1182431603 22:30302168-30302190 CTACCCTGCCTGCCTTAGGGAGG + Intronic
1182585343 22:31341591-31341613 TTGCCCAGCCTGCTTTGTGGAGG - Intronic
1183588808 22:38768255-38768277 CGGACCTGCCTGCTCTGAGGTGG + Intronic
1184517571 22:44972034-44972056 CTGCACTGAATGCTTTAGGGTGG + Intronic
950284114 3:11731568-11731590 TTTCCCTTACTGCTTTAAGGAGG - Intergenic
953982816 3:47421110-47421132 CTGCCCTGCCGGTTATGAGGTGG - Intronic
954456494 3:50602499-50602521 AGGCCCTGCCTGTTTTAATGAGG + Intergenic
959081042 3:101801477-101801499 CTCTGCTGCCTTCTTTAAGGTGG + Exonic
961497757 3:127306673-127306695 GTGCCCTGGCAGCTTCAAGGCGG + Intergenic
962146921 3:132849273-132849295 CTTCCCTGACTTCTGTAAGGTGG + Intergenic
963882848 3:150547265-150547287 CTGGCCTTCCTGCCTTAATGAGG + Intronic
964921016 3:161895949-161895971 CTGCCCTGCTTGTTCTTAGGGGG + Intergenic
967124905 3:186414477-186414499 TTTCCCTGACAGCTTTAAGGAGG - Intergenic
967739354 3:192987880-192987902 CTGCCTTGCCTTCTTTTGGGCGG + Intergenic
968087401 3:195880100-195880122 GTGATCTGCCTGCTTTGAGGCGG - Intronic
969494691 4:7519899-7519921 CTGCCCCGCCTGCTTAACAGGGG - Intronic
970094941 4:12452794-12452816 CTACCCTGGCTGCTTTTAGATGG - Intergenic
974229587 4:59092169-59092191 CTGACCTGCCTGCAGAAAGGAGG + Intergenic
977039834 4:92002228-92002250 CTGCCCTGCTGGCTCTAAAGAGG + Intergenic
983299295 4:165904483-165904505 CTTCCCTGCCTGCTTATAAGGGG - Intronic
983412297 4:167416879-167416901 CTGCCGTGGCTGCTAAAAGGGGG - Intergenic
983936696 4:173507590-173507612 CTCCCCTACCTGCTTGAAAGGGG + Intergenic
988599221 5:32623943-32623965 AGGCCATGCCTGGTTTAAGGGGG + Intergenic
988616169 5:32777209-32777231 CTGCCTTGCCTGTTTAAAAGGGG + Intronic
989508145 5:42251533-42251555 CTACTCTGCCTGATTTAAGCAGG - Intergenic
989532016 5:42518720-42518742 ATGCCCCGCCTTCTTCAAGGAGG - Intronic
990506105 5:56447131-56447153 CTGCCCTGCCTTCTTCACTGTGG - Intergenic
993044515 5:82852406-82852428 CTTCCCTGCCAGATTTCAGGGGG - Intergenic
995534817 5:113124534-113124556 CTGCCAAGCCAGGTTTAAGGTGG - Intronic
997507545 5:134430096-134430118 CTGCCCTGCCCCCTCTCAGGAGG + Intergenic
997700312 5:135893317-135893339 ATGCCTGGCCTGCATTAAGGAGG - Intronic
998628655 5:143874394-143874416 GTGCCCAGCCTGCATTAAGAAGG - Intergenic
999379552 5:151110641-151110663 CTCCCCTCCCTGCTCTCAGGTGG - Exonic
1001335526 5:170793347-170793369 CTGGCCTGGCTTCTTGAAGGTGG + Intronic
1003728947 6:8799033-8799055 CTGCCCTGCCTCCTGTCATGTGG - Intergenic
1006840181 6:37023359-37023381 ATGCCCTGCCTGAGTTATGGAGG - Intronic
1007015928 6:38466600-38466622 CTGCTTTGCCTTCTTTAAGAAGG - Intronic
1011664366 6:89620652-89620674 CTTCCCTACCTGCCTTCAGGTGG - Intronic
1014616108 6:123601580-123601602 CAGCCCTGACTGCTTAGAGGAGG - Intronic
1015619932 6:135120757-135120779 CTGCCCAACCTGCTTCAGGGAGG - Intergenic
1016573331 6:145539470-145539492 TTGCCCTGCCAGCGATAAGGAGG + Intronic
1017822044 6:158056624-158056646 CTGGGCAGCCTGCTTTCAGGGGG - Intronic
1017859128 6:158378973-158378995 CTGCCCTTCTTGCTCTAAAGTGG - Intronic
1018618784 6:165711123-165711145 CTCCCCTTCATGCTTAAAGGTGG - Intronic
1019940279 7:4283946-4283968 GTGCCCTGCCTCCTCCAAGGTGG + Intergenic
1020761116 7:12269328-12269350 CTGCCCTGCCAGCTTGGAAGGGG - Intergenic
1020798117 7:12700626-12700648 CTGACCTGCCAGCTTCAATGTGG + Intergenic
1023653980 7:42401471-42401493 TTGCCCTGCCTGCTTTGGGGAGG - Intergenic
1025942748 7:66086150-66086172 CTGCCCTGCCTACTTGAATGAGG + Intronic
1029626700 7:101724467-101724489 CTGCCCTGCCTCCTCCAAGACGG + Intergenic
1030029031 7:105351906-105351928 CTGCACAGCCTGCTTTACAGTGG - Intronic
1030029038 7:105351996-105352018 CTGCACAGCCTGCTTTACAGTGG - Intronic
1030925604 7:115450132-115450154 CTGCACTGCCTGCTTAGTGGAGG + Intergenic
1030972822 7:116081497-116081519 CTGCCCTGCCTTAGTTAAGTAGG + Intronic
1032504245 7:132423936-132423958 CAGCCCCGCCTGGTTCAAGGGGG - Intronic
1033222468 7:139537574-139537596 CTTCCCTCCCTGGTTTAGGGTGG + Intronic
1034198036 7:149262681-149262703 CCGCCCAGCCTGCTGTAGGGGGG - Intronic
1035231202 7:157467053-157467075 CTGCCCTGCCTGCTTTAAGGAGG + Intergenic
1036386774 8:8288593-8288615 CTGCCCTGCCTTCTCGACGGAGG + Intergenic
1036782513 8:11659314-11659336 CTGTCCTGCCTGCTTCCAGAGGG + Intergenic
1036796779 8:11761825-11761847 CTGCCTTGCTTGCTTGAAGCTGG + Exonic
1036798482 8:11772516-11772538 CTGCCCTGTCTGCTTTAGGTGGG + Intronic
1039432905 8:37539552-37539574 TTGACCTGGCTGGTTTAAGGTGG - Intergenic
1041754283 8:61296539-61296561 CTGGCATGCTTGCTTTAGGGAGG + Intronic
1042741950 8:72059030-72059052 CAGCCCTGGTGGCTTTAAGGTGG - Intronic
1042757568 8:72233616-72233638 CAGCCCTGATTGCTTTGAGGTGG - Intergenic
1042983266 8:74554482-74554504 TTGCCCTGCCTTCTTTCAAGGGG + Intergenic
1047012878 8:120691600-120691622 CTGCCCTGCCTGCAACAATGTGG + Intronic
1047730213 8:127721628-127721650 TTGTCCTGGCTGCTTTAATGTGG - Intergenic
1049388287 8:142355119-142355141 CTGCCCTGCCTGCATGGCGGGGG - Intronic
1049579949 8:143406710-143406732 CTGCCCTGCCTGCCTCAGGCTGG + Intergenic
1053155942 9:35779320-35779342 CTCCCTTGCTTACTTTAAGGGGG - Intergenic
1054944518 9:70781794-70781816 TTGCCCTTCCTGCTTTAATATGG - Intronic
1055350432 9:75381025-75381047 ATGCACTGCCTGTTTAAAGGGGG + Intergenic
1057014865 9:91642625-91642647 CTGCTCTGCCTGCCTGCAGGAGG + Intronic
1057353382 9:94317962-94317984 AGGCCCCGCCTGCTTTAGGGAGG - Intergenic
1057654369 9:96939630-96939652 AGGCCCCGCCTGCTTTAGGGAGG + Intronic
1057704078 9:97385644-97385666 CAGCCCTGGCTGCTTTGAAGAGG - Intergenic
1057849090 9:98550729-98550751 CTGCCCTGCCTGCTTTGGAGGGG + Intronic
1059379930 9:113915254-113915276 CTGCCCTGCCTGTCGTATGGTGG + Intronic
1061047407 9:128174079-128174101 CTGCCCTGGGGGCTTTGAGGAGG + Intronic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1062376160 9:136262825-136262847 CTGCCCTCCCTGCCTTACAGAGG + Intergenic
1062615918 9:137395628-137395650 CTGCCCTCCCTGCTGAAAGCTGG - Intronic
1185956278 X:4494388-4494410 CTGCAGTGCCTCCTTTAAGAAGG - Intergenic
1186452262 X:9683606-9683628 GTGCCCTGTGTGCTTTCAGGGGG + Intronic
1187443765 X:19343427-19343449 CTGCCCTGTCTACTTGAACGCGG - Intergenic
1193968892 X:88025588-88025610 ATGCTCTGCCTCCTTTAAGGTGG - Intergenic
1197790446 X:130248924-130248946 CTGCCCTGCCTGCTGCCAGTGGG + Intronic
1198083488 X:133261719-133261741 CTGCCCTGCTGGCTTTGAAGGGG + Intergenic
1198234647 X:134725689-134725711 ATGCCCTGCATGTTTTAAGGAGG - Intronic
1199977025 X:152900167-152900189 CTGCCCTGCCAGATCTCAGGAGG - Intergenic
1201744602 Y:17357889-17357911 CTGCAGTGCCTCCTTTAAGATGG - Intergenic