ID: 1035234085

View in Genome Browser
Species Human (GRCh38)
Location 7:157485022-157485044
Sequence CTGAGTCCACACATGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035234079_1035234085 15 Left 1035234079 7:157484984-157485006 CCTCTGAGCAGAAGGGTGGGTTC No data
Right 1035234085 7:157485022-157485044 CTGAGTCCACACATGCAGCCAGG No data
1035234075_1035234085 19 Left 1035234075 7:157484980-157485002 CCTCCCTCTGAGCAGAAGGGTGG No data
Right 1035234085 7:157485022-157485044 CTGAGTCCACACATGCAGCCAGG No data
1035234084_1035234085 -9 Left 1035234084 7:157485008-157485030 CCGGGGGCTCTCTGCTGAGTCCA No data
Right 1035234085 7:157485022-157485044 CTGAGTCCACACATGCAGCCAGG No data
1035234078_1035234085 16 Left 1035234078 7:157484983-157485005 CCCTCTGAGCAGAAGGGTGGGTT No data
Right 1035234085 7:157485022-157485044 CTGAGTCCACACATGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035234085 Original CRISPR CTGAGTCCACACATGCAGCC AGG Intergenic
No off target data available for this crispr