ID: 1035237458

View in Genome Browser
Species Human (GRCh38)
Location 7:157508179-157508201
Sequence ACCGCAGGGACTGCCTGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035237452_1035237458 2 Left 1035237452 7:157508154-157508176 CCTTTCATCATCAGGGTCTGTGA No data
Right 1035237458 7:157508179-157508201 ACCGCAGGGACTGCCTGGGCGGG No data
1035237448_1035237458 30 Left 1035237448 7:157508126-157508148 CCTGGTGGGCTGGGAGGAGGTTC No data
Right 1035237458 7:157508179-157508201 ACCGCAGGGACTGCCTGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035237458 Original CRISPR ACCGCAGGGACTGCCTGGGC GGG Intergenic
No off target data available for this crispr