ID: 1035243657

View in Genome Browser
Species Human (GRCh38)
Location 7:157548550-157548572
Sequence CCGGGGCCTGCGCTTTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035243657_1035243669 28 Left 1035243657 7:157548550-157548572 CCTCCACAAAGCGCAGGCCCCGG 0: 1
1: 0
2: 0
3: 23
4: 139
Right 1035243669 7:157548601-157548623 GAACATCCTCCTGAGGGTTCTGG 0: 1
1: 0
2: 1
3: 7
4: 122
1035243657_1035243668 22 Left 1035243657 7:157548550-157548572 CCTCCACAAAGCGCAGGCCCCGG 0: 1
1: 0
2: 0
3: 23
4: 139
Right 1035243668 7:157548595-157548617 AGCTCAGAACATCCTCCTGAGGG 0: 1
1: 0
2: 3
3: 13
4: 183
1035243657_1035243670 29 Left 1035243657 7:157548550-157548572 CCTCCACAAAGCGCAGGCCCCGG 0: 1
1: 0
2: 0
3: 23
4: 139
Right 1035243670 7:157548602-157548624 AACATCCTCCTGAGGGTTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 133
1035243657_1035243667 21 Left 1035243657 7:157548550-157548572 CCTCCACAAAGCGCAGGCCCCGG 0: 1
1: 0
2: 0
3: 23
4: 139
Right 1035243667 7:157548594-157548616 GAGCTCAGAACATCCTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035243657 Original CRISPR CCGGGGCCTGCGCTTTGTGG AGG (reversed) Intronic
900021938 1:191535-191557 CTGGGGCCTGAGCTGCGTGGTGG + Intergenic
900356571 1:2267933-2267955 CCGGGGCCTGTGTGCTGTGGTGG + Intronic
901744028 1:11360814-11360836 ACGAGGTCTGTGCTTTGTGGTGG - Intergenic
903833490 1:26188653-26188675 CCGTGGGCTGCGCTGTGTGGGGG - Exonic
903835920 1:26203165-26203187 CAGGGTCCTAAGCTTTGTGGAGG + Intergenic
906208670 1:44000391-44000413 CCAGGGCCTTGGCTATGTGGTGG - Intronic
908184728 1:61641866-61641888 CCTGGGCCTGCTCTCTGCGGCGG - Intergenic
909491701 1:76233516-76233538 CCAGTGCATGCCCTTTGTGGTGG - Intronic
910200218 1:84690818-84690840 CCGGGGCCGGGGCTCTGTGGGGG + Intergenic
912555421 1:110512655-110512677 CCGGAGCCTGCTCCTTGTTGGGG + Intergenic
915362491 1:155294618-155294640 CCGAGACCTGCGCTTCGGGGTGG - Exonic
1063395070 10:5678763-5678785 CCAGGGCCTGAGCGTGGTGGAGG - Intergenic
1064120118 10:12611264-12611286 ACAGGGCCTGCGTTTAGTGGAGG - Intronic
1071515375 10:86293355-86293377 CAGGGGCCTGAGCAGTGTGGGGG - Intronic
1072636393 10:97181226-97181248 CAGAGGCCTGCGCTGTGTAGGGG - Intronic
1073048616 10:100654216-100654238 CCGGGGCCAGCGTTTGGCGGAGG - Intergenic
1074464102 10:113666752-113666774 CCTGGACCTGGGCTTGGTGGTGG + Intergenic
1075334466 10:121598357-121598379 GCGGCGCCCGAGCTTTGTGGCGG + Exonic
1076345641 10:129777274-129777296 TGGGGGTCTGCGCTGTGTGGAGG - Intergenic
1076380870 10:130023771-130023793 CCGGGCCCAGCGCCCTGTGGGGG - Intergenic
1076613158 10:131738863-131738885 CAGGGGCGTGGGTTTTGTGGGGG - Intergenic
1076674266 10:132140198-132140220 CCTGGCCCTGCCCTTGGTGGTGG - Intronic
1076674374 10:132140597-132140619 CCGGGTCCTGGGCTTGGAGGAGG + Intronic
1076674386 10:132140636-132140658 CCGGGTCCTGGGCTTGGAGGAGG + Intronic
1076773221 10:132678639-132678661 CCGTGACCTGGGCATTGTGGTGG + Intronic
1077227583 11:1445123-1445145 CCGTGGCCTGCGCTGGGTGCGGG + Intronic
1078600391 11:12725030-12725052 CCCAGGCCTGGGCTTGGTGGTGG + Intronic
1083433317 11:62626277-62626299 CTGGGGCCTGATCCTTGTGGGGG - Intronic
1084760525 11:71267900-71267922 CAGGGGCCTGCCCTGGGTGGTGG - Intergenic
1088804755 11:113341998-113342020 CCAGGGCCTGGCCTTTGGGGAGG - Intronic
1090913328 11:131141008-131141030 CTGAGGCATGTGCTTTGTGGAGG - Intergenic
1091823836 12:3494721-3494743 CTGGGTACTTCGCTTTGTGGAGG - Intronic
1096345151 12:50839953-50839975 TTGGGGCCTGGGCTTTGGGGAGG - Intergenic
1096585902 12:52619473-52619495 CTGGGGCCTGTGCTTTTTGGGGG - Intergenic
1103400336 12:120639651-120639673 CCGGTGCTTGAGCTTTGCGGGGG - Intergenic
1104112548 12:125717393-125717415 GCGGGGCAGGCGCTTTCTGGAGG + Intergenic
1104442728 12:128807549-128807571 GCTGAGCCTGCGCTTTGGGGAGG + Intronic
1104953309 12:132451959-132451981 ACGGGGTCTGCGCTCTGAGGAGG + Intergenic
1114649044 14:24271528-24271550 CCAGCGCCTGGGCTCTGTGGCGG - Exonic
1119385678 14:74257085-74257107 CCGGGGCCTGCGGTTTGTCTGGG - Intronic
1119850385 14:77862425-77862447 CCTGGCCCTTCTCTTTGTGGGGG + Intronic
1121088303 14:91163522-91163544 CCGGGCCCTGCGATTTGAGCAGG + Intronic
1122787773 14:104171843-104171865 CGGGGGCCTGCGCTGCCTGGGGG - Exonic
1122830423 14:104393085-104393107 CTGGGGCCAGCACTGTGTGGGGG + Intergenic
1123472920 15:20568258-20568280 CCTGGGACTGGGCTTTGTGGAGG + Intergenic
1123645085 15:22432095-22432117 CCTGGGACTGGGCTTTGTGGAGG - Intergenic
1123666377 15:22611870-22611892 CATGGGTCTGGGCTTTGTGGAGG - Intergenic
1123733225 15:23163250-23163272 CATGGGTCTGGGCTTTGTGGAGG + Intergenic
1123751354 15:23360625-23360647 CATGGGACTGGGCTTTGTGGAGG + Intronic
1124283726 15:28384543-28384565 CCTGGGACTGGGCTTTGTGGAGG + Intronic
1124298971 15:28527070-28527092 CCTGGGACTGGGCTTTGTGGAGG - Intronic
1124320196 15:28706284-28706306 CATGGGTCTGGGCTTTGTGGAGG - Intronic
1124482317 15:30089133-30089155 CATGGGTCTGGGCTTTGTGGAGG + Intronic
1124488775 15:30141235-30141257 CATGGGTCTGGGCTTTGTGGAGG + Intronic
1124521262 15:30408073-30408095 CATGGGTCTGGGCTTTGTGGGGG - Intronic
1124537399 15:30558144-30558166 CATGGGTCTGGGCTTTGTGGAGG + Intronic
1124543858 15:30610199-30610221 CATGGGTCTGGGCTTTGTGGAGG + Intronic
1124563812 15:30797632-30797654 CATGGGTCTGGGCTTTGTGGAGG + Intergenic
1124754753 15:32397088-32397110 CATGGGTCTGGGCTTTGTGGAGG - Intronic
1124761257 15:32449443-32449465 CATGGGTCTGGGCTTTGTGGAGG - Intronic
1124777377 15:32599620-32599642 CATGGGTCTGGGCTTTGTGGAGG + Intronic
1124959448 15:34383609-34383631 CCTGGGTCTGGGCTTTGTGGAGG - Intronic
1124976074 15:34529830-34529852 CCTGGGTCTGGGCTTTGTGGAGG - Intronic
1127773299 15:62247193-62247215 CATGGGTCTGGGCTTTGTGGAGG - Intergenic
1127774614 15:62255205-62255227 CATGGGTCTGGGCTTTGTGGAGG - Intergenic
1128576997 15:68783107-68783129 AAGGGGCCTGTGCTGTGTGGGGG - Intronic
1129691724 15:77717703-77717725 CCCGGGCCTGGGCTTGGTGGGGG - Intronic
1131471650 15:92702877-92702899 TCTGGGCCTGCGCCTGGTGGGGG - Intronic
1132433079 15:101776059-101776081 CCTGGGTCTGGGCTTTGTGGAGG - Intergenic
1132451292 15:101969928-101969950 CTGGGGCCTGAGCTGGGTGGTGG - Intergenic
1132956730 16:2598248-2598270 CGGGGGCCGCAGCTTTGTGGAGG + Exonic
1136229570 16:28878508-28878530 CGGGGGTCAGAGCTTTGTGGAGG + Exonic
1139632276 16:68237785-68237807 AGGGCGCCTGCGCTTGGTGGAGG + Intronic
1142178026 16:88653897-88653919 CAGGGGCCTGCCCTGTGGGGTGG - Intronic
1147310214 17:39591595-39591617 CCAGGGCCTGCCCTTTGCTGGGG + Intergenic
1147989528 17:44324482-44324504 CCCGGGCCTGCATTTTGGGGCGG - Intronic
1148579519 17:48734129-48734151 CCGGAGCCTGCGCTTGGCAGGGG + Intergenic
1148895120 17:50835133-50835155 CCGGCCCCGGCCCTTTGTGGGGG - Intronic
1149993937 17:61397238-61397260 CAGGGGCCGGAGCTTTGTTGTGG + Intergenic
1151508785 17:74545753-74545775 CCAGGGCCTGGGCCTCGTGGCGG - Exonic
1152394508 17:80024095-80024117 CCCGGAGCTGCGCTTTGTCGCGG - Intronic
1154324568 18:13380493-13380515 CCGACCCCTGTGCTTTGTGGAGG - Intronic
1154364618 18:13695701-13695723 CCAGGGCCTGCGGTGGGTGGGGG + Intronic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1160566235 18:79788237-79788259 GCGGGGCCTGCGCTGTGCGCGGG - Intergenic
1161736838 19:5996738-5996760 CCGAGGCCTCCCCTGTGTGGCGG + Intronic
1162393680 19:10404319-10404341 CCTGGCCCCGCGCTTGGTGGGGG + Intronic
1164759708 19:30719727-30719749 CCGGGGCCTGCGTGTCGTCGCGG + Intergenic
1165403860 19:35618393-35618415 CCGGGGCCTGGGGTCTGGGGTGG - Exonic
1165854234 19:38870254-38870276 GCGGGGCCTGCGGGGTGTGGGGG + Exonic
1165912239 19:39236673-39236695 CCGGGGCCTGGGCCTTGCTGAGG + Intergenic
1168316374 19:55486491-55486513 CAGCGGCCTGCGCTTTGTCCTGG + Exonic
929460375 2:42098846-42098868 CCTAGGCCTGCTCCTTGTGGAGG + Intergenic
929538966 2:42805030-42805052 CCGGGGCCTGCGGATGGTGGAGG + Intergenic
932015684 2:68024125-68024147 CCAGGTCCTGCGCTTTCTGGTGG - Intergenic
933276382 2:80288749-80288771 CCAGGCCCAGCTCTTTGTGGGGG - Intronic
936567508 2:113592409-113592431 CTGGGGCCTGAGCTGGGTGGTGG - Intergenic
937139907 2:119590927-119590949 TGGGGGCCTGCGCTGTGTGCTGG - Intronic
937436777 2:121887786-121887808 CCAGGCCCTGCGCCTTCTGGCGG - Intergenic
943258527 2:185628991-185629013 CAGGGACCTTGGCTTTGTGGAGG - Intergenic
945053827 2:205850524-205850546 TAGGGGCCTGCTCTTTGTTGGGG - Intergenic
1175213248 20:57375076-57375098 CCGGGGGCTGCACTTTATGAAGG + Intronic
1176170973 20:63696257-63696279 TCGTGGCCTGGGCTTGGTGGTGG + Intronic
1176213921 20:63939395-63939417 TGGGGGCCTGCGCTTGGAGGCGG - Intergenic
1179417374 21:41209212-41209234 CAGGTGCCTGCGCCTTCTGGGGG + Intronic
1179590930 21:42407359-42407381 CCGTGGCCTACACTTTCTGGAGG - Intronic
1180163044 21:46006613-46006635 CCTGGGCCGGAGCTGTGTGGGGG - Intergenic
949687512 3:6592742-6592764 CCGGGGCCTGTCCTTGGTTGGGG + Intergenic
955392418 3:58531187-58531209 AGGGGACCTGCGCTTTGTGCAGG - Intronic
955769184 3:62372265-62372287 CGGGGGCCTGCGCATTGAGGAGG + Exonic
958417121 3:93887767-93887789 CTGGGGCCTGAGCTGTGGGGAGG - Intronic
962051429 3:131819866-131819888 CTGGGCCCTGCGCTTTGGGCAGG - Intronic
962990558 3:140573656-140573678 CAGGGCCCTGGGCTTTGGGGTGG + Exonic
964572113 3:158118834-158118856 TGGGGGCCTGCCCTTTTTGGGGG + Intronic
966399878 3:179537316-179537338 CAGGAGTCTGAGCTTTGTGGAGG - Intergenic
967896033 3:194396919-194396941 CCAGGGCCTGCGCACCGTGGGGG + Exonic
968703549 4:2067638-2067660 CTGGCGCCTGGGCTTTGTGGGGG + Exonic
968734120 4:2286334-2286356 CCGAGGCCTGCCCTTTGCGGGGG + Intronic
969493020 4:7510625-7510647 CCGGGGCCGGCGCCTTGTTCTGG + Intronic
984588327 4:181588075-181588097 CAGGGGCATGCGCTTTTTAGAGG + Intergenic
986171406 5:5317729-5317751 CCCGGGCTTGGGCTTTGTGGGGG - Intronic
986649166 5:9946854-9946876 ACGGGGCCGGCTCCTTGTGGAGG - Intergenic
992468256 5:77028836-77028858 CCTGGGCCTGAGATTTGTGGAGG - Intergenic
992747689 5:79835443-79835465 CCGGGGCCTGAGCTTGGTTGCGG + Intergenic
998402975 5:141857617-141857639 CTGGGGCCTGTGCTTTCGGGAGG - Intronic
999240361 5:150124188-150124210 GCGGGGCCTGGCCTTGGTGGTGG + Intronic
1002559460 5:180071741-180071763 CCGGGGCCGGCGCCTAGAGGCGG + Exonic
1005895257 6:30172232-30172254 CCTGGGTCTGGGCGTTGTGGAGG - Exonic
1007093676 6:39200278-39200300 GCTGGGCCTGAGCTTTGTGCAGG - Intronic
1012742258 6:103033074-103033096 CTGGTGCCTGCTCTTTTTGGAGG - Intergenic
1016459175 6:144263986-144264008 CCAGGGCATGCGCTCTGAGGTGG + Intergenic
1019031975 6:169021340-169021362 CAGGGGCCTGCCTTTTGTGTCGG + Intergenic
1019257647 7:62104-62126 CCGGGGCCTGGGGTCTGTGGAGG + Intergenic
1019319465 7:409067-409089 CCAGGGCCTTCGCTCTGTGCTGG + Intergenic
1024337916 7:48228211-48228233 CTGGGGCCTGTGCTTTGGGGAGG + Intronic
1024639451 7:51317110-51317132 CCGGGGCCGGCGCCTCCTGGCGG + Intergenic
1025709190 7:63891572-63891594 CTGGGGCCTTCACTTTGGGGAGG - Intergenic
1031919442 7:127590062-127590084 CCAGGGCCTCATCTTTGTGGTGG + Exonic
1033176974 7:139133812-139133834 GCGCGGCCTTCGCTGTGTGGTGG + Exonic
1034896252 7:154878153-154878175 CCTGGGCCTGCCCTTGATGGCGG - Intronic
1035243657 7:157548550-157548572 CCGGGGCCTGCGCTTTGTGGAGG - Intronic
1036224114 8:6943785-6943807 GCGGGGCCTGAACTTTGTGTGGG + Intergenic
1042803576 8:72747125-72747147 CCTGGGGCTTCCCTTTGTGGTGG - Intronic
1049242722 8:141546590-141546612 CTGGGCCTTGCGCCTTGTGGAGG + Intergenic
1049593358 8:143472532-143472554 CCAGGGTCTGAGCTTTGGGGAGG - Intronic
1049885026 9:21124-21146 CTGGGGCCTGAGCTGGGTGGTGG + Intergenic
1051235395 9:14993507-14993529 CCGGGGTCTGCGGTTTGCTGCGG + Intergenic
1052746936 9:32450152-32450174 CCAGGGCCTGCGCTGGCTGGTGG - Exonic
1056665487 9:88577941-88577963 CAGGGGCCTGCGCCTAGGGGCGG - Intronic
1058700225 9:107594191-107594213 CCTGGGTCTGATCTTTGTGGAGG + Intergenic
1061063248 9:128261336-128261358 CATGGGTCTGGGCTTTGTGGCGG - Intronic
1061359462 9:130131821-130131843 CTCGTGCCTGGGCTTTGTGGTGG + Intronic
1062042333 9:134409825-134409847 CCGTGCCCTGGGCCTTGTGGAGG + Intronic
1062108127 9:134766830-134766852 CCTGGGGCTGCTCTCTGTGGTGG + Intronic
1062158120 9:135065415-135065437 CCTGGACCTGGGCTCTGTGGAGG + Intergenic
1062324439 9:136005400-136005422 CCTGGGGCTGGGCTTGGTGGTGG + Intergenic
1062354922 9:136157412-136157434 CCTGGGCCTGCTCGTGGTGGGGG + Intergenic
1189171843 X:38916751-38916773 CCAGGGCCTCCCCTTTGAGGTGG + Intergenic
1189316730 X:40062075-40062097 GCGGGGCCTGCGGACTGTGGTGG - Intronic
1189482768 X:41405888-41405910 CCAGGGCCTGCCCTTGTTGGGGG + Intergenic
1191150749 X:57219384-57219406 CTGTGGCCTGCTCTTTGGGGTGG - Intergenic
1192361619 X:70444605-70444627 CGGGTGCCTGAGCTTTCTGGTGG + Intergenic
1195068556 X:101258681-101258703 ACTGGGCCTGCGGTTGGTGGGGG + Intronic