ID: 1035244108

View in Genome Browser
Species Human (GRCh38)
Location 7:157551298-157551320
Sequence TTAAATTGCAGCACAGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035244108_1035244111 9 Left 1035244108 7:157551298-157551320 CCCAGAACTGTGCTGCAATTTAA 0: 1
1: 0
2: 1
3: 26
4: 223
Right 1035244111 7:157551330-157551352 ATACCACAACTGTAGGCAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 134
1035244108_1035244110 2 Left 1035244108 7:157551298-157551320 CCCAGAACTGTGCTGCAATTTAA 0: 1
1: 0
2: 1
3: 26
4: 223
Right 1035244110 7:157551323-157551345 GTGAAAAATACCACAACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035244108 Original CRISPR TTAAATTGCAGCACAGTTCT GGG (reversed) Intronic
904191929 1:28751925-28751947 TCAAATGGCAGCACAGTGCTTGG + Intronic
906876604 1:49545686-49545708 TAAAATTTTAGCACAGTTCTTGG + Intronic
909788308 1:79642534-79642556 TAAAAATCCAGCACAGTTCATGG - Intergenic
909840916 1:80322046-80322068 TTAAAATGCAGCATAGCTCAAGG - Intergenic
911395765 1:97306895-97306917 TGAAAATGCTGCACAGATCTTGG - Intronic
912142876 1:106752889-106752911 TTACAGTGCAGCACAGTTGAGGG + Intergenic
912324602 1:108746192-108746214 TAAAAGTCCAGCACAGTTCTTGG + Intergenic
916125854 1:161570400-161570422 TTACATTGTCCCACAGTTCTTGG + Intergenic
916135768 1:161652248-161652270 TTACATTGTCCCACAGTTCTTGG + Intronic
916472143 1:165134590-165134612 TTAACATGCAGCACAGTGGTGGG - Intergenic
916615404 1:166434202-166434224 TTTAATTGCAGCATTTTTCTGGG - Intergenic
916919475 1:169448812-169448834 TGAAATTGTTCCACAGTTCTTGG + Intronic
917114864 1:171592760-171592782 TTAATTAGTGGCACAGTTCTAGG - Exonic
917885234 1:179377791-179377813 TCAAATTGCAGGACAATTTTAGG + Intronic
921929991 1:220747246-220747268 TTAAACTGTGGCACAGTTCTAGG - Intergenic
924107241 1:240661334-240661356 TGAAATTGTCCCACAGTTCTTGG + Intergenic
924879302 1:248141849-248141871 TTGAGTTGCAGCACTGTACTAGG - Intergenic
1063152308 10:3347812-3347834 TTAAATGGCAGCAGTGTTCTGGG - Intergenic
1065633808 10:27710254-27710276 TTTCATTGCAGGACAATTCTAGG - Intronic
1065960454 10:30730104-30730126 TGTAATTGCCCCACAGTTCTTGG + Intergenic
1067664288 10:48261143-48261165 TGAAATTGTTCCACAGTTCTTGG - Intronic
1067907016 10:50302715-50302737 TGAAATTGTCCCACAGTTCTTGG - Intergenic
1067942801 10:50670188-50670210 TTGAATTACAGCCCAGCTCTAGG + Intergenic
1068889145 10:62130596-62130618 TTTATTTGCCTCACAGTTCTGGG - Intergenic
1070159676 10:73858605-73858627 TGAAATGGAAGCACAGTTCTAGG + Intronic
1071767355 10:88682685-88682707 TTAGATTGCAACACGGTTCTCGG - Intergenic
1072484690 10:95843939-95843961 TCATATTACAGCTCAGTTCTTGG - Intronic
1072830619 10:98654379-98654401 TGAAATTGTCGCACATTTCTTGG + Intronic
1075885830 10:125898303-125898325 TTATGTTGCAGCTCTGTTCTAGG + Intronic
1078890452 11:15551767-15551789 TGAAATTGTCTCACAGTTCTTGG + Intergenic
1079013891 11:16852344-16852366 TTGCTTTGCAGGACAGTTCTGGG - Exonic
1079807439 11:24951313-24951335 TCAAATGTCAGCACAATTCTTGG + Intronic
1080323871 11:31048003-31048025 TTAAAGTTGAGCCCAGTTCTTGG - Intronic
1081678352 11:44984383-44984405 TAAAACTCTAGCACAGTTCTAGG + Intergenic
1086001998 11:81995521-81995543 ATAATTTGCAGCTCATTTCTGGG - Intergenic
1086166400 11:83784276-83784298 TTAAATTGTACAACAGTTTTAGG - Intronic
1087968855 11:104454314-104454336 TTAATCTGCATCACACTTCTTGG - Intergenic
1091061643 11:132468849-132468871 TTAGAGTGCAGGAGAGTTCTGGG - Intronic
1091455454 12:604132-604154 TTGAAATTCCGCACAGTTCTAGG + Intronic
1094034748 12:26056217-26056239 TGAAAATGAAGCACAGCTCTTGG + Intronic
1095488384 12:42707885-42707907 TTAAAATGCAGCACAGATGATGG + Intergenic
1095634080 12:44410811-44410833 TGAAATTGCCCCACAGTTCCTGG - Intergenic
1095666385 12:44805191-44805213 TGAAATTGCATCACATTTATGGG - Intronic
1097492924 12:60293386-60293408 TGATATTGCACCACAGATCTTGG + Intergenic
1097666490 12:62483403-62483425 TTAAAATCCAACACAGGTCTGGG + Intronic
1098881254 12:75919785-75919807 CTAAATAGCAGCTCAGGTCTGGG + Intergenic
1098992572 12:77080156-77080178 ATACATGGCAGCACAGTTCCAGG - Intergenic
1099136199 12:78905785-78905807 TTAAATTACAGCACATTACAAGG + Intronic
1100566399 12:95798310-95798332 TGAAATTGCAGCACAGGTTTAGG - Intergenic
1101205202 12:102480230-102480252 TTAAAGTGAAGAACAGTTCTAGG + Intronic
1103487872 12:121295576-121295598 GTAAATGGCAGCACAGCTCTAGG + Intronic
1103610276 12:122119752-122119774 TTAAACTGCAGCACTGTTTGCGG - Intronic
1104709956 12:130978788-130978810 TTAAAATGCAGCAAAGTTTTTGG + Intronic
1106971210 13:35144307-35144329 CTAGATAGCATCACAGTTCTGGG - Intronic
1107886851 13:44880839-44880861 TTGACTTTCAGCACAGCTCTTGG - Intergenic
1108721175 13:53134388-53134410 GTAAATTGTGGCACAGGTCTAGG + Intergenic
1109209464 13:59517836-59517858 TGTAATCACAGCACAGTTCTTGG - Intergenic
1109921810 13:69073608-69073630 CTAACTTGCATCACAGTTGTAGG + Intergenic
1110203888 13:72887999-72888021 TTATTTTACAGCACAGTTCTTGG + Intronic
1111127647 13:83932286-83932308 TGAAATTGTACCACAGTTCTTGG - Intergenic
1111604629 13:90520967-90520989 TCAAATTGCACCACAGTTAAAGG + Intergenic
1114546531 14:23506725-23506747 CTAAATTCCAGGACAGTGCTGGG - Intronic
1114849186 14:26362279-26362301 TTAAATTTCAGCAAAAGTCTAGG - Intergenic
1114951146 14:27755633-27755655 TTTAATTGACCCACAGTTCTGGG + Intergenic
1115061272 14:29193030-29193052 TTAAATTACATCAAACTTCTTGG + Intergenic
1115490466 14:33953179-33953201 TTAAATTGCAGCAAAGGGCCAGG + Intronic
1115899474 14:38128987-38129009 TCACTTTGCACCACAGTTCTAGG - Intergenic
1116110437 14:40572977-40572999 TTAAATAAAAGCACAGTTTTAGG + Intergenic
1116521105 14:45848176-45848198 TTAAATTTCAGCATAATTTTAGG - Intergenic
1117323516 14:54647385-54647407 GTAAGTGGCAGAACAGTTCTAGG + Intronic
1117625204 14:57629377-57629399 TTAAACTGCAGGAGAGTTGTTGG + Intronic
1118274802 14:64376566-64376588 TTAAATTGCTACACATTTCAGGG + Intergenic
1118429006 14:65696718-65696740 GTAAATTGTCCCACAGTTCTTGG + Intronic
1120994210 14:90403405-90403427 TTAACCTGCAGCTCAGTTCTAGG + Intronic
1121002282 14:90460496-90460518 TTACATTGCAGCAAAGCTCATGG + Intergenic
1121715648 14:96071902-96071924 TTGAGCTTCAGCACAGTTCTGGG + Intronic
1202872245 14_GL000225v1_random:175650-175672 TTATGTTGCAGCTCTGTTCTAGG - Intergenic
1123824848 15:24070740-24070762 TTAAATGGCAGCAAGGTTGTGGG - Intergenic
1125258681 15:37797497-37797519 TTGAATTGCAGCACACTAGTTGG - Intergenic
1125619640 15:41048640-41048662 TGAAATTGAAACACATTTCTTGG - Intronic
1127675392 15:61233326-61233348 TGAAAATGCAGCACTGCTCTTGG + Intergenic
1131574713 15:93576301-93576323 TGAAATTGTCCCACAGTTCTTGG + Intergenic
1136622502 16:31438842-31438864 TTAAATGGTAGCTCACTTCTAGG - Intronic
1137528231 16:49256143-49256165 TGAAATTGCTCCACAGTTTTGGG - Intergenic
1138039710 16:53650102-53650124 TTAAATTTCAGCATGATTCTTGG - Intronic
1138981450 16:62273864-62273886 TTTAATTGACTCACAGTTCTGGG + Intergenic
1139302415 16:65956746-65956768 TTAGTTTTCAGCACAGTGCTAGG - Intergenic
1140135068 16:72198655-72198677 TTATATTTCAGCACAGGTTTGGG - Intergenic
1145872361 17:28285405-28285427 TTTGATTGAAGCAGAGTTCTAGG - Intergenic
1146494551 17:33309831-33309853 TTAAATTTGAACACAGTGCTTGG + Intronic
1146977509 17:37127546-37127568 TTAAAATGCAGGACTTTTCTGGG - Intronic
1148008399 17:44453863-44453885 TTTGATTGAAGCAGAGTTCTAGG - Intronic
1149269308 17:54959155-54959177 TAAAATTGTAGCACCATTCTGGG + Intronic
1149518776 17:57302678-57302700 TTAGCTTGCAGCACTTTTCTTGG + Intronic
1150024078 17:61653494-61653516 TGTAATTGCCCCACAGTTCTTGG - Intergenic
1150948054 17:69768834-69768856 GAAATTTTCAGCACAGTTCTTGG - Intergenic
1153095159 18:1392584-1392606 CTAAATTTCAGCACTGTCCTGGG - Intergenic
1153374518 18:4360198-4360220 TTAAACTTTAGCACACTTCTTGG - Intronic
1155131899 18:22943952-22943974 GTTAATTGTAGCACAGTGCTTGG + Intronic
1156642124 18:39114979-39115001 TTTTATTGCAGGTCAGTTCTTGG - Intergenic
1157775040 18:50387514-50387536 TTTGATTGCCTCACAGTTCTTGG + Intronic
1159539681 18:69759760-69759782 TTAACTTGCAGCAAAGTTAAAGG + Intronic
1160381279 18:78458016-78458038 TCAAAATGCAGCATAGTTGTTGG - Intergenic
1164544180 19:29145412-29145434 TTAATTTGCACCCCAGTCCTTGG + Intergenic
1164546817 19:29172855-29172877 TTAAATTGTCTCACAGTTCATGG - Intergenic
1165277751 19:34769601-34769623 TGAAATTACAGCTCACTTCTTGG + Intronic
925191828 2:1891395-1891417 TTAAGATGCAGCACAGACCTGGG - Intronic
928720534 2:34115820-34115842 TTAAAATGCTGCACAGGTGTAGG - Intergenic
929906722 2:46052604-46052626 TAAAATCCCAGCAGAGTTCTTGG + Intronic
931509300 2:62972881-62972903 TTGAATTACAGCACACCTCTGGG + Intronic
931757459 2:65386566-65386588 TAAGTTTGCAGCACTGTTCTGGG - Intronic
933566755 2:83959679-83959701 TTAAATTACATCACAGTGCCTGG + Intergenic
934082649 2:88482602-88482624 ATTAGTTTCAGCACAGTTCTGGG + Intergenic
934212470 2:89994753-89994775 TTATATTGCAGCAGAGTTTAAGG + Intergenic
934486213 2:94714068-94714090 TTTAATTGACTCACAGTTCTTGG - Intergenic
935973997 2:108559515-108559537 TTAGTTTGCAGCACAGTGCTAGG + Intronic
936875489 2:117184352-117184374 CTAAATTGCTGGAAAGTTCTGGG + Intergenic
938542071 2:132291487-132291509 TTAAATGTCAGCATATTTCTGGG + Intergenic
940116447 2:150214089-150214111 TAAAATTTCAACAGAGTTCTTGG + Intergenic
940975771 2:159942503-159942525 ATTTATTGCAGCACAGTGCTGGG - Intronic
941051168 2:160735643-160735665 TAAAATTGTAGAACATTTCTTGG - Intergenic
941479636 2:165990601-165990623 TTAAATTTCACCATATTTCTGGG - Exonic
942508606 2:176671382-176671404 TCACATAGCAGCACAGTTCCAGG - Intergenic
944005245 2:194896855-194896877 TTCAATCCCAGCACAGCTCTAGG + Intergenic
944455163 2:199885615-199885637 GTAAATTACAGTTCAGTTCTAGG - Intergenic
945826929 2:214732307-214732329 TGCAATCGCAGGACAGTTCTGGG - Intronic
945984401 2:216342220-216342242 TTAAAGTTCAGCACAGTTCCTGG - Intronic
946509594 2:220340334-220340356 TAAAATTGAAGCACAATTATTGG + Intergenic
1169908518 20:10627630-10627652 TTAAATTCAAGCCCAGTACTGGG - Exonic
1170724931 20:18917891-18917913 TTAGATTACATCACTGTTCTAGG + Intergenic
1171159593 20:22909177-22909199 TTACGTTGCAGCAAAATTCTAGG - Intergenic
1171323936 20:24274171-24274193 CGAAATTGCCCCACAGTTCTTGG + Intergenic
1171870954 20:30524362-30524384 TTAAATGTCAGCATATTTCTGGG + Intergenic
1172489130 20:35320268-35320290 TAAAGTTGTAGCACAGTTATTGG - Intronic
1173167879 20:40698792-40698814 TTAGACTGCAGCACTGCTCTAGG + Intergenic
1173432684 20:43004573-43004595 TTAAACTGCAGCACAATTGGTGG - Intronic
1175568075 20:59996471-59996493 ATAAAGTTCAGCACAGTTCCAGG - Intronic
1177336023 21:19728867-19728889 TTAAATTGCAGCACCATTTGAGG - Intergenic
1180285855 22:10743834-10743856 TTATGTTGCAGCTCTGTTCTAGG + Intergenic
1183781908 22:40004178-40004200 CTAAATTTCAGCACAGTGGTAGG + Intronic
949644756 3:6080003-6080025 CAAAATATCAGCACAGTTCTTGG + Intergenic
949832878 3:8235171-8235193 TGAAATTGCCCCACAGTTCTTGG - Intergenic
951120663 3:18923532-18923554 TTAAATTGTCCCACAGATCTTGG - Intergenic
951444549 3:22763591-22763613 TTAGACTGCAGCATAGTTTTAGG - Intergenic
951499400 3:23367399-23367421 TTAACTTTCAGCACAGATGTTGG - Intronic
951695133 3:25438443-25438465 TTAAATTAAAGAACAGTTGTGGG + Intronic
956906911 3:73776052-73776074 TTAAATTAAAGCATATTTCTGGG + Intergenic
958544726 3:95529963-95529985 TTAAATTATTGCATAGTTCTAGG + Intergenic
958545631 3:95545710-95545732 TAAAATTGTTCCACAGTTCTTGG - Intergenic
960188627 3:114675700-114675722 TTAAACTAAAGCAAAGTTCTTGG + Intronic
960308391 3:116090530-116090552 CTAAATTGCAGCAACATTCTAGG - Intronic
965368977 3:167837326-167837348 TTAAATTACAGCAGATTTCCAGG + Intergenic
966720693 3:183060117-183060139 TTAAATTGTCCCACAGTTCTTGG + Intronic
968197887 3:196724383-196724405 TCAAATTTCAACACAGTTTTTGG + Intronic
969450433 4:7269781-7269803 TTTATTTTCATCACAGTTCTGGG - Intronic
971144366 4:23961082-23961104 TAAAAAAGCAGCACAATTCTAGG + Intergenic
972669971 4:41205907-41205929 TTAAATTGCAGAGCAGCACTGGG + Intronic
974805891 4:66880374-66880396 TTAAATGGCAGCACAGTTTAAGG + Intergenic
977251980 4:94699596-94699618 TTAAGTTGCTCCACAGTTCTAGG + Intergenic
978607998 4:110503707-110503729 TCAAATTACAGCACAGTTGAGGG - Intronic
978685795 4:111441608-111441630 TTAAATTTCTGTACAGATCTGGG - Intergenic
979724614 4:123945539-123945561 TTAAATTGGAGAACACTTCCTGG + Intergenic
981123238 4:141076589-141076611 TTAAATTTCAGCACCTTTGTGGG + Intronic
981705591 4:147656014-147656036 TTATCTTGCAGCACTGTTATAGG - Intronic
981892039 4:149749857-149749879 TTACAATCCAGCACAGATCTTGG - Intergenic
985583108 5:710566-710588 TGAAATGGGAGCACAGTACTGGG - Intronic
986599683 5:9459348-9459370 TAAAATTGCAGCACCCATCTTGG + Intronic
987473249 5:18358303-18358325 TTAAAATACAGAACAGTTCATGG - Intergenic
988718805 5:33855190-33855212 TTTAAGTGCAGTTCAGTTCTTGG - Intronic
989297637 5:39848465-39848487 CTAAATTGCAGGAAAGTTCACGG + Intergenic
991022165 5:61990873-61990895 CTGAATTGTAGCACAGCTCTGGG - Intergenic
991986846 5:72297217-72297239 TTAAACTGCAGCAGAGTGATGGG - Intronic
995823951 5:116271696-116271718 TTGATTTGCAGCATAGTCCTTGG + Intronic
995972189 5:117985918-117985940 TTAAATTGCAGCATAATATTAGG + Intergenic
996133741 5:119813289-119813311 TGTAATTGGACCACAGTTCTTGG + Intergenic
997458436 5:134035087-134035109 TGCTATTGCAGCACAGTGCTTGG - Intergenic
999896960 5:156044956-156044978 TTCAATTGGCTCACAGTTCTAGG + Intronic
1000116839 5:158161527-158161549 TTCACTTGCAGAACTGTTCTGGG + Intergenic
1001163447 5:169341889-169341911 TCACACTGCAGCACAGTGCTAGG + Intergenic
1002941913 6:1724712-1724734 TCAAATGGCAGCACAGCTCAGGG + Intronic
1003357542 6:5387900-5387922 TTTAATTTCAGAATAGTTCTAGG + Intronic
1003645875 6:7912389-7912411 TTTAACTGAAACACAGTTCTAGG + Intronic
1008093885 6:47318965-47318987 ATAAATTGCCCCACTGTTCTTGG - Intergenic
1008219798 6:48842275-48842297 TCAAATTGCATCACAGTTCAAGG - Intergenic
1009527930 6:64770692-64770714 TTAAAATGCATCATATTTCTAGG + Intronic
1010318356 6:74476554-74476576 TTATATGGCTGCATAGTTCTAGG + Intergenic
1011770990 6:90673998-90674020 TAAAAATGCAGCCCAGTTCATGG - Intergenic
1013677796 6:112485952-112485974 TAAAGTTTCAGCACAGCTCTAGG + Intergenic
1013810255 6:114036942-114036964 TTCATTAGCAGCACAGTTCTAGG - Intergenic
1015042145 6:128734013-128734035 TTAATTTTCAACTCAGTTCTGGG - Intergenic
1015283146 6:131455841-131455863 TTAGATTGCAGGTCAGTTTTGGG - Intergenic
1015494680 6:133867500-133867522 TGAAAATGGACCACAGTTCTTGG + Intergenic
1016507535 6:144799486-144799508 TTTAAATGCAGCAGGGTTCTTGG + Intronic
1022945816 7:35282456-35282478 TCAGACTGTAGCACAGTTCTAGG + Intergenic
1024853782 7:53753057-53753079 TGAAACTGCCCCACAGTTCTTGG + Intergenic
1025935556 7:66033210-66033232 TAAAAGTTTAGCACAGTTCTTGG + Intergenic
1026223438 7:68420382-68420404 CTAAATTGGAGCACAGCTTTTGG - Intergenic
1026333287 7:69372121-69372143 TTAAATCTCTGAACAGTTCTAGG - Intergenic
1026999128 7:74639570-74639592 AGAAATTTCAGCACTGTTCTAGG - Intergenic
1027947450 7:84766904-84766926 TGAAATTGTCCCACAGTTCTTGG + Intergenic
1028265732 7:88722313-88722335 TTAACTGGCAGCTCAGATCTCGG + Intergenic
1031925363 7:127633498-127633520 TTATATTGCCTCACAGTTCTGGG + Intergenic
1031980300 7:128120342-128120364 TCAAATTGCAGCTCAACTCTGGG - Intergenic
1035244108 7:157551298-157551320 TTAAATTGCAGCACAGTTCTGGG - Intronic
1035872639 8:3152720-3152742 TTAAATAGCAACACAGTTGATGG - Intronic
1037216127 8:16453951-16453973 TTAAATTTCAGTACAGTACCAGG + Intronic
1038148717 8:24922801-24922823 TTAAATTGGATCACAGCTATAGG + Intergenic
1038548785 8:28447192-28447214 ATAAATTGCAGGACAGAACTAGG - Exonic
1038878790 8:31583479-31583501 TGAAATTGTCCCACAGTTCTTGG + Intergenic
1039534038 8:38291985-38292007 TTTAATTGGAGCACTGTTTTGGG + Intronic
1039859081 8:41440870-41440892 TTAATATGAAGCACGGTTCTAGG + Intergenic
1040720535 8:50316819-50316841 GTAAATTTCAGCACAGTGCTTGG - Intronic
1040722249 8:50338773-50338795 TTAAATTGTTCCACATTTCTTGG - Intronic
1045310361 8:100995732-100995754 TCAAGTTGCAGGACAGTTATTGG + Intergenic
1045781584 8:105870767-105870789 TTAAATGGAAACACAGTTCCTGG - Intergenic
1046045877 8:108963754-108963776 AAAAATTGGTGCACAGTTCTTGG + Intergenic
1046190514 8:110789168-110789190 TGAAATTGAAGCAGAGTGCTGGG + Intergenic
1046212662 8:111098790-111098812 TTAAATTGCAGCTCTTTGCTTGG + Intergenic
1047249563 8:123171434-123171456 TTAAATGGCAGGACACGTCTGGG + Intergenic
1047537681 8:125734449-125734471 TTAGACTGCAGCACAGTTCTAGG - Intergenic
1048706414 8:137158246-137158268 TAAAATTTCCACACAGTTCTTGG + Intergenic
1051322551 9:15923892-15923914 TAAGATTGCAGCCCAGATCTAGG + Intronic
1052456385 9:28704554-28704576 TGTAATTGTACCACAGTTCTTGG + Intergenic
1053671584 9:40370258-40370280 TTTAATTGACTCACAGTTCTGGG + Intergenic
1053921394 9:42996627-42996649 TTTAATTGACTCACAGTTCTGGG + Intergenic
1054382697 9:64510307-64510329 TTTAATTGACTCACAGTTCTGGG + Intergenic
1054513034 9:66006052-66006074 TTTAATTGACTCACAGTTCTGGG - Intergenic
1055021020 9:71669963-71669985 CTTTATTGCAGCACAGTTCCTGG - Intergenic
1055851440 9:80635529-80635551 TGAAATTGCCCCACAGTCCTTGG + Intergenic
1056039219 9:82644151-82644173 TCAAATTGGATCACAGGTCTAGG - Intergenic
1058399648 9:104599699-104599721 TTTAATATCATCACAGTTCTAGG + Intergenic
1058400113 9:104605908-104605930 TTTAATATCATCACAGTTCTAGG + Intergenic
1058819809 9:108719562-108719584 TTAAATTACACTAAAGTTCTGGG - Intergenic
1059190770 9:112323751-112323773 TGAAATTGTCCCACAGTTCTTGG - Intronic
1059857576 9:118416894-118416916 TGAATTTGCAACACAGTTCCAGG - Intergenic
1060197348 9:121632279-121632301 TTAAAGCTCAGCACAGTTCCTGG + Intronic
1203732207 Un_GL000216v2:100888-100910 TTATGTTGCAGCTCTGTTCTAGG + Intergenic
1187599376 X:20810436-20810458 ATAAATTGGAGCAAAATTCTGGG + Intergenic
1190583814 X:51917263-51917285 TTGAATTGAAGCACAGGTTTAGG - Intergenic
1192419807 X:71019665-71019687 GGAAATAGCAGCACAGTTCATGG - Intergenic
1193716931 X:84944544-84944566 TTAAATTACAGGAGAGTTTTAGG + Intergenic
1194057424 X:89152652-89152674 TTTTATTGAAGCACATTTCTTGG - Intergenic
1194115590 X:89892716-89892738 TTAATTAGGGGCACAGTTCTAGG - Intergenic
1194742209 X:97587121-97587143 ATAAATTGCAGGCCAGTTTTTGG + Intronic
1198269485 X:135041808-135041830 TTAAATTGACTCACAGTTCTGGG - Intergenic
1198602981 X:138304867-138304889 TTTAATTGGACCACAGTTCCAGG + Intergenic
1198656715 X:138922530-138922552 TTAATTTGCTGCTCAGCTCTAGG + Intronic
1199061945 X:143366340-143366362 TAAAATTGTTTCACAGTTCTTGG - Intergenic
1200468384 Y:3549851-3549873 TTAATTAGGGGCACAGTTCTAGG - Intergenic
1201630117 Y:16062464-16062486 TTAAATTGTACCACACTTCTTGG + Intergenic
1202628732 Y:56886670-56886692 TTATGTTGCAGCTCTGTTCTAGG - Intergenic