ID: 1035244110

View in Genome Browser
Species Human (GRCh38)
Location 7:157551323-157551345
Sequence GTGAAAAATACCACAACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035244109_1035244110 1 Left 1035244109 7:157551299-157551321 CCAGAACTGTGCTGCAATTTAAA 0: 1
1: 0
2: 1
3: 14
4: 160
Right 1035244110 7:157551323-157551345 GTGAAAAATACCACAACTGTAGG No data
1035244108_1035244110 2 Left 1035244108 7:157551298-157551320 CCCAGAACTGTGCTGCAATTTAA 0: 1
1: 0
2: 1
3: 26
4: 223
Right 1035244110 7:157551323-157551345 GTGAAAAATACCACAACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035244110 Original CRISPR GTGAAAAATACCACAACTGT AGG Intronic
No off target data available for this crispr