ID: 1035247851

View in Genome Browser
Species Human (GRCh38)
Location 7:157576577-157576599
Sequence GCGCGCACTGCCCTGCCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 135}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035247843_1035247851 9 Left 1035247843 7:157576545-157576567 CCGAAGCCTCGCTCCCCTGTGCC 0: 1
1: 1
2: 1
3: 33
4: 315
Right 1035247851 7:157576577-157576599 GCGCGCACTGCCCTGCCGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 135
1035247847_1035247851 -6 Left 1035247847 7:157576560-157576582 CCTGTGCCGCGCGCTCAGCGCGC 0: 1
1: 0
2: 2
3: 16
4: 98
Right 1035247851 7:157576577-157576599 GCGCGCACTGCCCTGCCGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 135
1035247844_1035247851 3 Left 1035247844 7:157576551-157576573 CCTCGCTCCCCTGTGCCGCGCGC 0: 1
1: 0
2: 3
3: 17
4: 205
Right 1035247851 7:157576577-157576599 GCGCGCACTGCCCTGCCGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 135
1035247845_1035247851 -4 Left 1035247845 7:157576558-157576580 CCCCTGTGCCGCGCGCTCAGCGC 0: 1
1: 0
2: 1
3: 13
4: 121
Right 1035247851 7:157576577-157576599 GCGCGCACTGCCCTGCCGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 135
1035247842_1035247851 29 Left 1035247842 7:157576525-157576547 CCAGGGGCGTCTCAGGAGCACCG 0: 1
1: 0
2: 2
3: 6
4: 104
Right 1035247851 7:157576577-157576599 GCGCGCACTGCCCTGCCGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 135
1035247846_1035247851 -5 Left 1035247846 7:157576559-157576581 CCCTGTGCCGCGCGCTCAGCGCG 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1035247851 7:157576577-157576599 GCGCGCACTGCCCTGCCGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035247851 Original CRISPR GCGCGCACTGCCCTGCCGGC GGG Intronic
900091872 1:924239-924261 CCCCGGACTGCCCAGCCGGCCGG - Intergenic
900103008 1:970857-970879 GCCCTCTCTGCCCTGCCCGCAGG + Exonic
900461804 1:2805322-2805344 GTGGGCCCTGCCCTGCCTGCAGG - Intergenic
903004698 1:20290943-20290965 GCGCCCGCTGCCCTGGCAGCTGG - Exonic
903683301 1:25112025-25112047 GCCCGCAGTGCCCTGCCTGCTGG - Intergenic
903724657 1:25431375-25431397 CCGCGCCCTGCCCGCCCGGCCGG - Intronic
904458039 1:30658888-30658910 GAGGGGACAGCCCTGCCGGCTGG - Intergenic
905137050 1:35808116-35808138 GCGCCCCCTTCCCTCCCGGCGGG + Intergenic
905631872 1:39523186-39523208 GGCCTCACTGCCCTCCCGGCTGG - Intronic
905789081 1:40780890-40780912 GCACCCAGTGCCCAGCCGGCAGG + Intergenic
906109288 1:43312478-43312500 GCCCGCACTGCCCTCCTGACGGG + Exonic
907931038 1:59000452-59000474 GCACGGACTGCCCCGCTGGCAGG - Intergenic
912800842 1:112718992-112719014 GCGCTCCCCGGCCTGCCGGCAGG + Intergenic
913714387 1:121519347-121519369 GCGCGCCCTCCCCGGCCTGCTGG + Intergenic
915335229 1:155136985-155137007 GCACGCCCTGCCTTGCTGGCAGG + Intronic
919699813 1:200620585-200620607 GCGACCACTGCTCTGCGGGCGGG - Exonic
922166114 1:223117088-223117110 CCGAGCCCTGCCCTGCAGGCAGG + Intronic
922488883 1:225999459-225999481 GCCCGCACCGCCCCGCCGCCCGG - Intergenic
924436749 1:244049084-244049106 GCCCGCGCCGCCCAGCCGGCCGG - Intronic
1062830390 10:601692-601714 GCGCCCACTGCCCTGACTGCAGG + Intronic
1064029894 10:11877168-11877190 GGGTGCCCTGCCCTGGCGGCCGG + Intergenic
1067723234 10:48745875-48745897 GCGGGCCCTGCACTGTCGGCTGG + Intronic
1070763273 10:79039198-79039220 TCGCGCACTATTCTGCCGGCTGG - Intergenic
1070915052 10:80148209-80148231 GCGCCCACTGCCCTGGAGGGGGG + Intergenic
1075054450 10:119207333-119207355 GCGGGCACCGCCCGGCCGACAGG - Intergenic
1075054597 10:119207870-119207892 GCGCTGACAGCCCCGCCGGCCGG + Exonic
1075346261 10:121683975-121683997 GCCCGCACTGCCCTCTCAGCTGG + Intergenic
1076707057 10:132307877-132307899 CCGCTCCCGGCCCTGCCGGCCGG - Exonic
1076724176 10:132405606-132405628 GTGCGGACGGCCCTGCCGGTGGG + Exonic
1076731775 10:132442795-132442817 GTGCACCCTGCCCTGCCTGCTGG - Intergenic
1076878757 10:133230122-133230144 GCGCGCCCCGCCCCGCCCGCCGG - Intergenic
1078932741 11:15925199-15925221 GCGCATACTCCCCTGCGGGCAGG + Intergenic
1079111474 11:17607627-17607649 ACCCTCACTGCCCTGGCGGCTGG - Intronic
1081507604 11:43734525-43734547 GCACGGACTGCCCTGCTGGCAGG - Intronic
1081812903 11:45923172-45923194 GTGCGCGCGGCCCTGGCGGCGGG + Intronic
1082203684 11:49405200-49405222 GTCCTCACTGCCCTGCTGGCAGG - Intergenic
1083920648 11:65780173-65780195 GCCACCACTGCCCTGGCGGCGGG - Exonic
1084630028 11:70341947-70341969 GCGCTTACTTCCCTGCCAGCGGG - Intronic
1086651403 11:89295235-89295257 GTCCTCACTGCCCTGCTGGCAGG + Exonic
1088811396 11:113395157-113395179 GCCCGCACTGCCCTGCCCTTTGG - Intronic
1092952131 12:13516016-13516038 GGGCCCACTGCCCTGCCTCCTGG + Intergenic
1093633498 12:21437740-21437762 GCGCGCCCTCCCCCGACGGCAGG + Exonic
1096377399 12:51124601-51124623 GAGCGGACTGCCCCGCCGGCAGG + Intronic
1097051216 12:56224414-56224436 GCGTGCACAGTCCTGCCGGCTGG + Exonic
1098255483 12:68611228-68611250 GAGCGCGCTGCCTTGCGGGCCGG + Intronic
1101340905 12:103841226-103841248 CCGCGCTCTGCCCTGCAGGAGGG + Intergenic
1102101418 12:110281482-110281504 CCGCGGCCTGCCCTCCCGGCGGG + Intronic
1104692761 12:130839101-130839123 GGGCGCGCTGCCCGGCCGGCGGG - Exonic
1107011531 13:35675452-35675474 GCGGGCACTGTCATGCAGGCTGG - Intergenic
1107307522 13:39038339-39038361 GCGCGGACTGCCCTGAGGGCGGG + Exonic
1116624035 14:47242672-47242694 CCGAGCACTGCCCTGCGGGAAGG - Intronic
1117297459 14:54393115-54393137 CCGAGCCCTGCCCTGCGGGCAGG + Intergenic
1121449171 14:93996725-93996747 ACACGCACCACCCTGCCGGCTGG - Intergenic
1202881602 14_KI270722v1_random:66138-66160 GGGCTCCCTGCCCTGCCGGAGGG - Intergenic
1127165790 15:56243853-56243875 GCGCGCACTGGGCTGCCTCCGGG - Intergenic
1128357177 15:66936379-66936401 GCGTGGACTGCCCTTCCGGACGG - Intergenic
1129710717 15:77819173-77819195 GCGCGCGCCGCGCCGCCGGCGGG + Intronic
1129986889 15:79926209-79926231 GCACGGCCAGCCCTGCCGGCCGG + Intergenic
1132800248 16:1748477-1748499 GCCCACACTGCCCTGCAGGCCGG - Intronic
1132934562 16:2474107-2474129 GGCCGCCCTGCCCAGCCGGCGGG - Exonic
1133287882 16:4698881-4698903 GCGGGCACTGCTGTGCCAGCGGG + Exonic
1133762099 16:8807373-8807395 GCTCCCAGTTCCCTGCCGGCAGG + Intronic
1135045480 16:19151524-19151546 GCCAGCACTGCCCTGGGGGCAGG - Intronic
1140479186 16:75253355-75253377 GCAGGCAGTGCCCTGCTGGCAGG + Intronic
1141079124 16:81035728-81035750 GCGCGCCCTCCGCGGCCGGCAGG + Intergenic
1141132511 16:81445346-81445368 GGGCGCCGTGCCCTGCCGCCGGG + Exonic
1142136292 16:88453403-88453425 GCGCGGACTGCCCGACGGGCGGG - Exonic
1142136795 16:88455286-88455308 GCGCGCTCTGCCCGCCCCGCTGG - Intronic
1146329684 17:31917209-31917231 GCGGGCGCTGCCCTGCCCGGCGG + Intergenic
1147110439 17:38257359-38257381 GCGTGCGCGGCCCCGCCGGCCGG + Intergenic
1147726040 17:42566772-42566794 ACGCGCACTGTCCGGCCGGCCGG - Intergenic
1147833711 17:43315290-43315312 GCGCGCCTTGCCCTGTCGGCGGG - Intergenic
1148324632 17:46776176-46776198 GCAGGCACTGCCCAGCAGGCAGG - Intronic
1148419067 17:47531072-47531094 GCGTGCGCGGCCCCGCCGGCCGG - Exonic
1148670283 17:49405012-49405034 GCACGGACTGCCCCGCTGGCAGG + Exonic
1151972516 17:77466199-77466221 GCACCCACTGCCCAGCCAGCCGG + Intronic
1152900353 17:82937591-82937613 TCGCGCTCTGCCCTGGCGGGAGG + Intronic
1157222668 18:45838772-45838794 GCGCGCTCTGCACTGCCGAAGGG + Exonic
1159947828 18:74457221-74457243 GCGCGCGGGGCCCTGCCGGGTGG - Exonic
1160054263 18:75464583-75464605 GAGCACGCTGGCCTGCCGGCGGG + Intergenic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1162668694 19:12237212-12237234 GCGGGCACTGCGCTGCCGAGAGG + Intronic
1165673146 19:37696638-37696660 GCACGGACTGCCCTGCCGGCAGG + Exonic
1166688030 19:44807825-44807847 GCGCCCACTGCATTCCCGGCTGG + Intergenic
1167237192 19:48322099-48322121 GCGCCCACTGCCCGCCCGCCCGG - Intronic
1168694394 19:58396500-58396522 GCGCGCACCGCCCTCTCGCCAGG + Exonic
929070079 2:38020740-38020762 CCGAGCCCTGCCCTGCCGGGAGG - Intronic
934655984 2:96116958-96116980 GCCCGCCCTGCCCTCCCTGCGGG - Intergenic
935598128 2:104895955-104895977 GCCAGCACTGCCCTGCAGGTGGG + Intergenic
938727546 2:134120929-134120951 GCGCGCTCAGCCCTGCTGCCGGG + Intronic
944482813 2:200174964-200174986 CCGAGCCCTGCCCTGCCGGGAGG - Intergenic
945188873 2:207166377-207166399 GCTCGCGCTGCCCGGCCGCCGGG - Intronic
945194462 2:207225405-207225427 GAGCTCACTGCCCTGCAGGAAGG + Intergenic
1169367224 20:5001366-5001388 GCGCCCCCTGCCCGGCCTGCGGG - Intronic
1170924727 20:20712502-20712524 GCGCCTACTGCCCCGCCGGCGGG - Intergenic
1172771363 20:37384393-37384415 CCGCGCACTGACCGGCCAGCGGG - Exonic
1174386782 20:50192082-50192104 GCGCGCGTCCCCCTGCCGGCCGG + Exonic
1175448492 20:59042819-59042841 CTGCGCACTGCGCCGCCGGCTGG - Exonic
1176214851 20:63943140-63943162 GCCCGCACAGCTCTGCCAGCAGG - Intronic
1180098394 21:45572418-45572440 GCGCACACTCCCCTGCTGGAGGG + Intergenic
1181041302 22:20193945-20193967 GAGCCCACAGCCCTGCAGGCCGG + Intergenic
1182664047 22:31944609-31944631 ACGCGCACTGGCTCGCCGGCCGG - Exonic
1183548594 22:38468380-38468402 GAGCGCCCTGCCCTGCACGCAGG - Intronic
1184249015 22:43249749-43249771 GGGCCCACTGTCCTGCTGGCAGG - Intronic
1185065501 22:48629880-48629902 GCCCGCACTCCTCTGCCGGGAGG - Intronic
952593662 3:34988605-34988627 CCGAGCCCTGCCCTGCCGGAAGG - Intergenic
953522473 3:43656558-43656580 GCGAGCCCTGCCCTGCGGGAAGG + Intronic
955114400 3:55982999-55983021 GCGTGCACTGCCCTGCAAGCAGG - Intronic
955344410 3:58150267-58150289 GCACCCACTGCCCTGAAGGCTGG - Intronic
961081958 3:124034389-124034411 GCGCCCACCGCCCTCCCAGCTGG - Intergenic
961599809 3:128052085-128052107 GCGCGCGTGGCCCTGCAGGCAGG - Intronic
969032587 4:4226715-4226737 GCGCACACCGCCCCGCCGGGGGG + Exonic
969503654 4:7570438-7570460 GGGTGCTCTGCCCTGCAGGCTGG + Intronic
974590575 4:63943013-63943035 CCGAGCACTGCCCTGCGGGAAGG + Intergenic
976733209 4:88284531-88284553 GCGGCCACTGCCTTGCCTGCTGG + Exonic
978207176 4:106092532-106092554 CCGAGCCCTGCCCTGCGGGCAGG + Intronic
981920213 4:150078471-150078493 GCGCGCGCTGCCCGGCGGGCGGG + Intronic
984702124 4:182825281-182825303 GAGCGCCCTGGCCTGCGGGCAGG - Intergenic
987326274 5:16814184-16814206 TCGCGCACTGCCCTCCAGCCTGG - Intronic
989963354 5:50441127-50441149 GCGCGCCCTCCCCGGCCTGCTGG - Exonic
996281733 5:121738026-121738048 GCGGGCACAGCCCTGCCTCCTGG + Intergenic
998978213 5:147671595-147671617 GCGAGCACAGCTCTGCCTGCTGG - Intronic
1001035106 5:168291854-168291876 GCTCGCTCTGCCCGGCCGGCTGG + Intronic
1003290757 6:4776535-4776557 GCGCTCACTCCCCGGCGGGCCGG - Exonic
1004235520 6:13872052-13872074 CCGAGCCCTGCCCTGCCGGAAGG + Intergenic
1014027725 6:116668905-116668927 TCGCGCACTGCCCTCCAGCCTGG - Intergenic
1017008176 6:150043318-150043340 GCACGGACCGCCCCGCCGGCAGG - Intergenic
1020072818 7:5238689-5238711 GCGCGCACAGCTCTGTCTGCAGG + Intergenic
1022942584 7:35254367-35254389 GCGCGCACCGCCCTCCCGCCCGG - Intergenic
1024521088 7:50304539-50304561 GCGCGCACAGCGCCGCCCGCGGG - Intronic
1029407112 7:100381949-100381971 CCGAGCCCTGCCCTGCCGGGAGG - Intronic
1032011754 7:128351862-128351884 GCGCGCACGGCCCCGGTGGCGGG - Exonic
1033183264 7:139201600-139201622 GTGCACACTGCCATGCCTGCTGG + Intergenic
1034428647 7:151028648-151028670 GCCGGCACTGCCCTGCCGGGCGG - Intronic
1034677797 7:152903849-152903871 GCCCGCTCTGGCCTGCGGGCTGG + Intergenic
1035169581 7:157010083-157010105 GCGCGCAGTGCGCGGCCAGCAGG + Exonic
1035247851 7:157576577-157576599 GCGCGCACTGCCCTGCCGGCGGG + Intronic
1036223978 8:6942995-6943017 GGCAGCACTGCCCTGCAGGCCGG - Intergenic
1037417969 8:18671674-18671696 TCGCGCACTGCCCTCCAGCCTGG - Intronic
1037799737 8:22025773-22025795 GTGCGCATTTCCCTGCTGGCTGG + Intronic
1049105394 8:140609332-140609354 GCGGGCAGTGGCCTGCCGGGTGG + Intronic
1049798913 8:144508883-144508905 CCGCGCCCAGCACTGCCGGCCGG - Intergenic
1056365410 9:85899679-85899701 GCATGGACTGCCCTGCCCGCAGG - Intergenic
1060700490 9:125746597-125746619 GCGCGCACCGCCCCGGGGGCGGG + Intergenic
1061037003 9:128119458-128119480 GCGCATAGTGCCCTGCCGCCTGG - Intergenic
1061262112 9:129486174-129486196 GGCCGCACCGCCCTGCCTGCTGG - Intergenic
1061908088 9:133708925-133708947 GCCCCCACTCCCCTGCTGGCGGG - Intronic
1062585624 9:137248127-137248149 GTTCGCACAGCCCTGCAGGCCGG - Intergenic
1062624850 9:137438130-137438152 GCCCGGCCTCCCCTGCCGGCGGG + Intronic
1195909591 X:109876025-109876047 GCGAGCCCTGCCCCGCCGGGAGG + Intergenic
1198767168 X:140091587-140091609 GCGTGCGCCGCCCTGCGGGCGGG - Intergenic
1200047142 X:153409117-153409139 GCGCCCACTCCCCTGCCCCCCGG + Intergenic
1200212001 X:154350866-154350888 GGCCGCCCTGCCCTGCTGGCTGG - Intronic