ID: 1035247851

View in Genome Browser
Species Human (GRCh38)
Location 7:157576577-157576599
Sequence GCGCGCACTGCCCTGCCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 135}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035247842_1035247851 29 Left 1035247842 7:157576525-157576547 CCAGGGGCGTCTCAGGAGCACCG 0: 1
1: 0
2: 2
3: 6
4: 104
Right 1035247851 7:157576577-157576599 GCGCGCACTGCCCTGCCGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 135
1035247847_1035247851 -6 Left 1035247847 7:157576560-157576582 CCTGTGCCGCGCGCTCAGCGCGC 0: 1
1: 0
2: 2
3: 16
4: 98
Right 1035247851 7:157576577-157576599 GCGCGCACTGCCCTGCCGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 135
1035247844_1035247851 3 Left 1035247844 7:157576551-157576573 CCTCGCTCCCCTGTGCCGCGCGC 0: 1
1: 0
2: 3
3: 17
4: 205
Right 1035247851 7:157576577-157576599 GCGCGCACTGCCCTGCCGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 135
1035247846_1035247851 -5 Left 1035247846 7:157576559-157576581 CCCTGTGCCGCGCGCTCAGCGCG 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1035247851 7:157576577-157576599 GCGCGCACTGCCCTGCCGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 135
1035247843_1035247851 9 Left 1035247843 7:157576545-157576567 CCGAAGCCTCGCTCCCCTGTGCC 0: 1
1: 1
2: 1
3: 33
4: 315
Right 1035247851 7:157576577-157576599 GCGCGCACTGCCCTGCCGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 135
1035247845_1035247851 -4 Left 1035247845 7:157576558-157576580 CCCCTGTGCCGCGCGCTCAGCGC 0: 1
1: 0
2: 1
3: 13
4: 121
Right 1035247851 7:157576577-157576599 GCGCGCACTGCCCTGCCGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035247851 Original CRISPR GCGCGCACTGCCCTGCCGGC GGG Intronic