ID: 1035247922

View in Genome Browser
Species Human (GRCh38)
Location 7:157576940-157576962
Sequence GTTAACACTGGGAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 238}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035247922_1035247929 1 Left 1035247922 7:157576940-157576962 CCTCCCACCTTCCCAGTGTTAAC 0: 1
1: 0
2: 1
3: 23
4: 238
Right 1035247929 7:157576964-157576986 CACTGAAGTTAGCTCCGTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 52
1035247922_1035247932 26 Left 1035247922 7:157576940-157576962 CCTCCCACCTTCCCAGTGTTAAC 0: 1
1: 0
2: 1
3: 23
4: 238
Right 1035247932 7:157576989-157577011 TGTGTGCTTAGTGTTATTTAGGG No data
1035247922_1035247933 27 Left 1035247922 7:157576940-157576962 CCTCCCACCTTCCCAGTGTTAAC 0: 1
1: 0
2: 1
3: 23
4: 238
Right 1035247933 7:157576990-157577012 GTGTGCTTAGTGTTATTTAGGGG 0: 1
1: 0
2: 0
3: 11
4: 144
1035247922_1035247928 0 Left 1035247922 7:157576940-157576962 CCTCCCACCTTCCCAGTGTTAAC 0: 1
1: 0
2: 1
3: 23
4: 238
Right 1035247928 7:157576963-157576985 GCACTGAAGTTAGCTCCGTGCGG 0: 1
1: 0
2: 0
3: 7
4: 78
1035247922_1035247931 25 Left 1035247922 7:157576940-157576962 CCTCCCACCTTCCCAGTGTTAAC 0: 1
1: 0
2: 1
3: 23
4: 238
Right 1035247931 7:157576988-157577010 GTGTGTGCTTAGTGTTATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035247922 Original CRISPR GTTAACACTGGGAAGGTGGG AGG (reversed) Intronic
901097760 1:6695930-6695952 GTTAACAATGGGATAGAGGGAGG - Intronic
904923459 1:34027365-34027387 TGTAACACTGGCAAGGTGGGAGG + Intronic
905166148 1:36084389-36084411 GTTGGCACTGGGGAGCTGGGGGG - Intronic
905386430 1:37607363-37607385 GTGAACAGTGATAAGGTGGGAGG - Intergenic
911634004 1:100213441-100213463 GTAGACCCTGGGATGGTGGGTGG - Intronic
911755523 1:101549616-101549638 TTTAACACTGGGTAGGTAGGTGG - Intergenic
915524263 1:156466559-156466581 GTCAACACTGGGATGGTCTGTGG - Exonic
915842830 1:159229985-159230007 GTTAAAACTGGGAAGCAGGATGG - Intergenic
916077956 1:161213812-161213834 GTTAAGACTTGCAAGGTGGGAGG - Intronic
916083300 1:161250534-161250556 GTTAACACCGTGAAGGTCTGTGG + Intergenic
916751162 1:167723954-167723976 CTTAACACTTAAAAGGTGGGAGG + Intronic
920078622 1:203355394-203355416 GATAACTCAGGGAAGGTGGAGGG + Intergenic
920499935 1:206479718-206479740 GCTAAGGCTGGCAAGGTGGGAGG + Intronic
923032042 1:230256938-230256960 GTTCAGACTTGAAAGGTGGGAGG + Intronic
923539284 1:234876473-234876495 GTTCACTCGGGGGAGGTGGGTGG + Intergenic
1062915032 10:1238111-1238133 GTAAACACCGGGAGGGAGGGGGG - Intronic
1062915167 10:1238538-1238560 GTGAACACCGGGAGGGAGGGGGG - Intronic
1062915494 10:1239573-1239595 GTAAACACCGGGAGGGAGGGGGG - Intronic
1062915541 10:1239717-1239739 GTGAACACCGGGAGGGAGGGGGG - Intronic
1062915558 10:1239765-1239787 GTAAACACCGGGAGGGAGGGGGG - Intronic
1062915644 10:1240029-1240051 GTAAACACCGGGAGGGAGGGGGG - Intronic
1062915699 10:1240199-1240221 GTAAACACCGGGAGGGAGGGGGG - Intronic
1064056161 10:12099334-12099356 GTTACCTCTGCGGAGGTGGGAGG - Intronic
1064539650 10:16392424-16392446 GTAAGCTCTGTGAAGGTGGGGGG - Intergenic
1065170555 10:23022916-23022938 AGAAACACTGGGCAGGTGGGTGG + Intronic
1066301500 10:34101409-34101431 GCCACCACTGGGAAGGTGGCCGG - Intergenic
1066985967 10:42466661-42466683 GATAAGACTGGACAGGTGGGGGG + Intergenic
1069132993 10:64729298-64729320 GTTAACAATGGGAATGTACGAGG + Intergenic
1069752754 10:70754652-70754674 GATAACACTGGGGAGGCAGGCGG + Intronic
1070112529 10:73498881-73498903 ATGAACAATGGGAGGGTGGGAGG + Exonic
1070122207 10:73588832-73588854 GGTAGGACTGGGAAGATGGGAGG - Intronic
1070885383 10:79892121-79892143 CTTTAGATTGGGAAGGTGGGGGG - Intergenic
1073364367 10:102926182-102926204 GTTAAAACTTGGGAGGTGTGTGG - Intronic
1073973065 10:109066852-109066874 GTTACCAATGGGTGGGTGGGAGG - Intergenic
1074906162 10:117865693-117865715 GCCAACTCTGGGAAGCTGGGGGG - Intergenic
1076394319 10:130127705-130127727 GTTAACACAGGGAGGGAGAGAGG - Intergenic
1076566402 10:131402505-131402527 GTTAACACGGGGCAGGTGTGAGG + Intergenic
1076578872 10:131493564-131493586 GTTAACACAGAGAAGGTGGCTGG + Intergenic
1077600436 11:3571000-3571022 GGTAACACTGGGAAGGGTTGGGG - Intergenic
1078642769 11:13111736-13111758 TTTAACCCTGGGACAGTGGGTGG + Intergenic
1081606792 11:44532130-44532152 GTTGGGACTGGGGAGGTGGGAGG - Intergenic
1082263664 11:50097111-50097133 GATAAAACTGGGAAGGTGAGTGG + Intergenic
1083026263 11:59553673-59553695 CTTAACACTGGGAAGTAGGCCGG - Intergenic
1084256350 11:67945615-67945637 GGTAACACTGGGAAGGGTTGGGG - Intergenic
1084816416 11:71649683-71649705 GGTAACACTGGGAAGGGTTGAGG + Intergenic
1085763281 11:79260774-79260796 GGGAATACTGGGCAGGTGGGAGG - Intronic
1086184211 11:83994309-83994331 GTTACCACTTTGAAGGTGGAGGG + Intronic
1087247631 11:95858188-95858210 GTTAACACTAGCAATTTGGGAGG - Intronic
1087852756 11:103051509-103051531 GTTAACACAGGGGTGGCGGGGGG - Intergenic
1088777862 11:113103581-113103603 ATTATCACTGGGGAGGTGAGTGG - Intronic
1089356181 11:117855522-117855544 GTGGTCACTGGGAGGGTGGGAGG - Intronic
1091297214 11:134482326-134482348 GTTGCCACTGGGTGGGTGGGGGG + Intergenic
1092949473 12:13487919-13487941 GCTAAGTCTGGAAAGGTGGGTGG + Intergenic
1098338812 12:69430918-69430940 GTTAATTGTGGGTAGGTGGGTGG - Intergenic
1100956143 12:99910535-99910557 GTCTACACTGGGGAGATGGGAGG + Intronic
1101542613 12:105678544-105678566 GTGACCACTAGGAAGGAGGGTGG + Intergenic
1102020624 12:109679858-109679880 GTGCCCACTGGGCAGGTGGGAGG - Intergenic
1103612662 12:122133585-122133607 GGTAACACGGGGGAGATGGGCGG - Exonic
1104040712 12:125128515-125128537 GGGAACAGTGGGCAGGTGGGTGG + Intronic
1104675572 12:130709892-130709914 GGTAGCACTGGGCAGGAGGGAGG + Intronic
1105744067 13:23360576-23360598 GTTGACAGTGGGAAGGAAGGTGG - Intronic
1106142935 13:27026172-27026194 GTTACCACTGTGAAGAAGGGAGG - Intergenic
1108709041 13:53015512-53015534 GATAACATTGGGAAGATAGGAGG - Intergenic
1110424835 13:75355118-75355140 GTCCACACTGGGAATGTGGAAGG + Intronic
1111742576 13:92222246-92222268 GTTAAAAAGGGGAAGATGGGAGG + Intronic
1111987346 13:95078512-95078534 CTTTGCACTGGGAAGGTGGCAGG + Intronic
1113035105 13:106039583-106039605 GTTCACACTGGGAACCTGAGTGG + Intergenic
1113337988 13:109395152-109395174 GCTTACCCTGGGGAGGTGGGGGG - Intergenic
1113456966 13:110456194-110456216 GTTTACAAGGGGAAGGTGGTGGG + Intronic
1113880410 13:113622386-113622408 GGCAACACTGGAAGGGTGGGCGG - Intronic
1114911700 14:27207318-27207340 GTTAAAACTGTGAAGATAGGTGG + Intergenic
1115004173 14:28461113-28461135 GTTAACAGTGGGAAGGTTATGGG + Intergenic
1115562667 14:34597158-34597180 GTTACCATGGGGCAGGTGGGTGG - Intronic
1119762434 14:77161090-77161112 ATAAACACTGGGGAGGTGGCTGG - Intronic
1120535545 14:85690633-85690655 ATTCACATTGGGAAGGTGTGAGG + Intergenic
1122238607 14:100346977-100346999 GTAAGCACTGGGAAGGTGCCAGG + Intronic
1122365900 14:101194711-101194733 GTGAACACTGGGACTCTGGGTGG + Intergenic
1122580897 14:102770990-102771012 ATAAGCACGGGGAAGGTGGGAGG + Intergenic
1123124054 14:105932205-105932227 GTTACCACTGGGAAGGGAGTCGG - Intronic
1124083190 15:26520052-26520074 GGGAAAACTGGTAAGGTGGGTGG - Intergenic
1125639978 15:41222410-41222432 GTTAACAATGGGAAAGCGGCTGG - Intronic
1125701112 15:41684967-41684989 GTTAACACTTAAAATGTGGGTGG + Intronic
1128301778 15:66570553-66570575 GTGAAGACTGGGGAGGTTGGGGG - Intergenic
1129015553 15:72464984-72465006 GTTACCACTGGGGATGTGGGAGG + Intergenic
1129798379 15:78395258-78395280 ATTAACAAGGGGAAGATGGGAGG + Intergenic
1131380949 15:91963392-91963414 TTTAACTCGGGGAGGGTGGGGGG + Intronic
1132085096 15:98901895-98901917 ACTAACACTGGAGAGGTGGGTGG + Intronic
1134301502 16:12995620-12995642 CTTAACAGTGGGAAGGTGGAAGG - Intronic
1135161000 16:20096328-20096350 GTTGACAGAGGGCAGGTGGGAGG + Intergenic
1138324594 16:56153753-56153775 CTAAACAGTGGGCAGGTGGGAGG - Intergenic
1138528286 16:57621132-57621154 ATTAACAGAGGGAATGTGGGGGG - Intronic
1138631302 16:58296038-58296060 TTTAACCCTGGGCAGGGGGGCGG + Intronic
1140288654 16:73629135-73629157 GATGACACACGGAAGGTGGGAGG - Intergenic
1141105388 16:81229232-81229254 GTTTGCACTGGGAGGGTGGAAGG - Intergenic
1141498250 16:84425199-84425221 GTAGGGACTGGGAAGGTGGGTGG - Intronic
1141749020 16:85945988-85946010 GCTGGCACTGGGCAGGTGGGTGG + Intergenic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1146113837 17:30116396-30116418 GTGAACACTTGGAAGGGGGTAGG + Intronic
1146605340 17:34252804-34252826 GTAAACACAGGGAAGGTGAAGGG - Intergenic
1148488195 17:48004856-48004878 GTTAACATTGGGAGGGAGGTGGG + Intergenic
1148588167 17:48795834-48795856 GTAAACCCTGGGAGGCTGGGAGG - Intronic
1148683754 17:49489198-49489220 GTCAACAATGGGAAGATAGGAGG - Intergenic
1149251940 17:54780154-54780176 ATTAAAGCAGGGAAGGTGGGGGG + Intergenic
1149259309 17:54861606-54861628 GATAAGACTGAGAAGATGGGCGG - Intergenic
1149965618 17:61161007-61161029 GTTGACACAGGGAAGGGGGATGG - Intronic
1150096585 17:62381559-62381581 GTTAACAGTAGGAATGGGGGTGG - Intronic
1151147923 17:72058396-72058418 TTGAACTCTGGGAGGGTGGGGGG - Intergenic
1152496148 17:80673412-80673434 GTTATCACTGTGGAGGTGGAGGG + Intronic
1152523217 17:80872569-80872591 GTGCCCCCTGGGAAGGTGGGAGG + Intronic
1153089249 18:1324907-1324929 GGTAACACAGGGAAGGGAGGAGG + Intergenic
1153295025 18:3536828-3536850 GAGAACATGGGGAAGGTGGGAGG + Intronic
1155088676 18:22484246-22484268 GTTAACAGTGGGACTCTGGGTGG - Intergenic
1156742951 18:40355059-40355081 TTTAAAACTGGAATGGTGGGAGG + Intergenic
1157667205 18:49497881-49497903 ATTAACACTGGGCAGTTGGCCGG + Intergenic
1159368484 18:67501123-67501145 GTTACCTCTGGGATGGTTGGTGG + Intergenic
1159369506 18:67513284-67513306 TTTAAATCTGGGAAGCTGGGGGG - Exonic
1159920995 18:74227330-74227352 GTTCACACTGTGCAGGTGGATGG - Intergenic
1160383108 18:78475744-78475766 GTCAACACTGGGAGGGTAGGAGG + Intergenic
1160584477 18:79904756-79904778 GTTCGGACTGGGATGGTGGGTGG - Intronic
1161762342 19:6183317-6183339 GTCAAGAGGGGGAAGGTGGGTGG + Intronic
1161917601 19:7241067-7241089 GTTACCTCTGGGAAGAAGGGAGG + Intronic
1162050465 19:8029414-8029436 GTCACCACTGGGAGGCTGGGGGG - Intronic
1163693980 19:18753484-18753506 AGTAAGACTGGGGAGGTGGGAGG - Exonic
1164767890 19:30785512-30785534 GTTAAAACTGGGATAATGGGTGG - Intergenic
1165521327 19:36316607-36316629 CTGAACACTGGGAAAGTGAGGGG + Intergenic
1165622734 19:37261981-37262003 CTGAACACTGGGAAAGTGAGGGG - Intergenic
1165634433 19:37328616-37328638 CTGAACACTGGGAAAGTGAGGGG - Intronic
1165704586 19:37966648-37966670 GAAAACACTGGGGAGGAGGGTGG - Intronic
1166304032 19:41927843-41927865 CCCAACTCTGGGAAGGTGGGAGG - Intronic
1167587064 19:50381194-50381216 GTTAAAACTGGGAAGGTCCTGGG - Intronic
925259063 2:2513904-2513926 ATAAACACTGGAATGGTGGGTGG + Intergenic
925296348 2:2780024-2780046 GTGAACTCTGGGAAGGTGCAGGG - Intergenic
925296401 2:2780265-2780287 GTGAACTCTGGGATGGTGTGGGG - Intergenic
925296530 2:2780904-2780926 GTGAACTCTGGGAAGGTGCAGGG - Intergenic
925382749 2:3438277-3438299 GTTAATCCAGGGATGGTGGGGGG - Intronic
925729884 2:6911733-6911755 GTTATCACTGGGATGGTGATGGG + Intergenic
926118704 2:10229309-10229331 GTGAACAGGGGGAGGGTGGGGGG + Intergenic
926288582 2:11510545-11510567 GCTCACACAGGAAAGGTGGGAGG + Intergenic
927657232 2:24959579-24959601 GATAAGACTGGGAAGGTTGGTGG - Intronic
934085534 2:88506093-88506115 CTTTACACTGGGGAGGTGGGAGG + Intergenic
937000851 2:118466131-118466153 GATAACAGTGGGAATGTTGGTGG - Intergenic
939624647 2:144461971-144461993 GGTAAAAATGGGGAGGTGGGTGG - Intronic
941171200 2:162139672-162139694 GTTAACACTGGAAAGGTTGAGGG + Intergenic
941255791 2:163229792-163229814 GTAACAACTGGGAAGGTTGGAGG - Intergenic
942684088 2:178512431-178512453 TTTTACTCTGGCAAGGTGGGAGG + Exonic
944556272 2:200890695-200890717 GGCAACAGAGGGAAGGTGGGAGG - Intronic
946610795 2:221455496-221455518 ATAAACACTGGGAAGGTCGGGGG + Intronic
947293437 2:228603280-228603302 GTGAGCATTGGGAAGTTGGGGGG + Intergenic
948125781 2:235563924-235563946 GCTATCAGTGGGAAGCTGGGTGG + Intronic
948621468 2:239237714-239237736 GTTAGAACTGGGAAAGTGTGAGG + Intronic
948676268 2:239598661-239598683 GAGAACACTGGGAAGGAGGGAGG - Intergenic
1170930568 20:20766602-20766624 GTGAGCACTGGGTAGGTGGGTGG + Intergenic
1177715877 21:24839675-24839697 GTTAACACTGCGAGGGTCCGCGG - Intergenic
1178816452 21:35934553-35934575 GTTCAGTCTGGGAAGGTGGAGGG - Intronic
1179135463 21:38676630-38676652 GTAAACACTGGGAAGGAGCCAGG + Intergenic
1179918947 21:44496758-44496780 GGGAAGACTGGGGAGGTGGGCGG + Intergenic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1182666362 22:31963196-31963218 GTAGACACTGGGCAGGTGGCTGG + Intergenic
1183306822 22:37087189-37087211 ATTGACACTGGGAAGTTTGGGGG - Intronic
1183333001 22:37231384-37231406 GGAACCACTGGGCAGGTGGGTGG + Exonic
1183864114 22:40690597-40690619 GTCAAAGCAGGGAAGGTGGGGGG + Intergenic
956744641 3:72301750-72301772 ATAAACACTGGATAGGTGGGTGG + Intergenic
957071258 3:75569652-75569674 GGTAACACTGGGAAGGGTTGGGG - Intergenic
960450850 3:117806101-117806123 GCTCTCATTGGGAAGGTGGGAGG - Intergenic
960570665 3:119182256-119182278 GTGAACAGAGGGAAGGTGGAAGG + Intronic
962534352 3:136314409-136314431 GTTCACACTTGTAAGGAGGGCGG + Intronic
963769468 3:149375322-149375344 ATAAACACTGGCTAGGTGGGTGG + Intronic
964499692 3:157335147-157335169 GTTGGCACTGGGAAATTGGGAGG + Intronic
964683724 3:159370810-159370832 CTGAAAACTGGGGAGGTGGGAGG - Intronic
964785126 3:160387994-160388016 GTTATGACTGTGAAAGTGGGTGG + Intronic
967216293 3:187213284-187213306 GATGACAATGGGAAGGTGTGTGG - Intergenic
969014867 4:4097343-4097365 GGTAACACTGGGGAGGGTGGGGG - Intergenic
969294880 4:6263933-6263955 GGGAACACTGGGAAGGAGGGAGG + Intergenic
969566019 4:7978695-7978717 GTTATCACTGGTGGGGTGGGTGG - Intronic
969739078 4:9011093-9011115 GGTAACACTGGGAAGGGTTGGGG + Intergenic
969798269 4:9542618-9542640 GGTAACACTGGGGAGGGTGGGGG + Intergenic
975761427 4:77624233-77624255 GGCAACACAGTGAAGGTGGGGGG + Intergenic
976200131 4:82569873-82569895 GTAAAGACTGGGCAGTTGGGTGG - Intergenic
978097390 4:104794671-104794693 GTTAGGTCTGGGAAGGTGGTGGG + Intergenic
979408623 4:120345504-120345526 ATTAACACGGGAAAGGTGGGAGG + Intergenic
979938967 4:126735877-126735899 GTTGACACAGGGAGGGTGGGAGG - Intergenic
981585347 4:146295422-146295444 GTTTATTTTGGGAAGGTGGGGGG + Intronic
983005058 4:162474653-162474675 AGAAACACTGGAAAGGTGGGAGG - Intergenic
983641902 4:169950984-169951006 GGACACACTGGGAAGGTCGGAGG + Intergenic
987316615 5:16730413-16730435 ATTATCCCTGGGAAGGAGGGAGG + Intronic
991508601 5:67352084-67352106 TTTAACTATGGGAAGGTCGGTGG + Intergenic
992973576 5:82088094-82088116 GTTAGCTCTGGGAAAGTGAGTGG - Intronic
998566665 5:143221891-143221913 GTTGATACTGGGCAGGTGGGTGG + Intronic
1000146835 5:158461598-158461620 TTCAACACTGGGAATTTGGGTGG + Intergenic
1000261080 5:159589168-159589190 CCTAACACTGGGAACTTGGGTGG + Intergenic
1002278595 5:178118351-178118373 CTTATCACTGGGATGCTGGGAGG - Intronic
1002357298 5:178641218-178641240 GTTAAGACTGGGAAAGAGGCTGG + Intergenic
1002810788 6:626458-626480 GTGCACACTGGGAACGTGAGGGG - Intronic
1004902929 6:20210594-20210616 TTTAAAACTGGGAGGGAGGGAGG - Intronic
1005498410 6:26409153-26409175 GTTAAGAAAGGGAGGGTGGGAGG + Intronic
1005661498 6:28003242-28003264 GTTGACACTGTGCAGGTGCGTGG + Intergenic
1005841249 6:29745873-29745895 AGGAAAACTGGGAAGGTGGGAGG + Intergenic
1006025779 6:31145739-31145761 GTTGAGGCTGGGAAGCTGGGCGG + Exonic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007654689 6:43445117-43445139 GGGAACACTGGGATGCTGGGTGG - Exonic
1009052142 6:58289077-58289099 GTGAACACTGGGAAAGTAGCAGG + Intergenic
1013700354 6:112761078-112761100 ACTAAGACTGGGGAGGTGGGGGG - Intergenic
1015803063 6:137080281-137080303 ATCAACACTGGGAAGGTGCAAGG + Intergenic
1016581355 6:145632172-145632194 GTCACCACTGGGTAGCTGGGAGG - Intronic
1017262293 6:152401557-152401579 GTTAACACTGGGTGGGAGAGTGG + Intronic
1018089338 6:160332028-160332050 GTGAAGACTGGGAATATGGGGGG + Intergenic
1018102305 6:160451618-160451640 GTTCACATTGCGAAGGTGTGCGG - Exonic
1018172955 6:161155913-161155935 GTTGGCCCTGGGAAGGTGAGAGG + Intronic
1018886015 6:167938129-167938151 CCTGACACTGGGAAGGTGAGTGG + Intronic
1019439964 7:1041031-1041053 GTTCCCACAGGGAACGTGGGAGG - Intronic
1020055751 7:5116802-5116824 GATAGAACTGGGAGGGTGGGTGG + Intergenic
1020405534 7:7829418-7829440 GTTATCCCTGGCAATGTGGGAGG + Intronic
1022274321 7:28840840-28840862 GTGAACACTTGGAAGGGGAGTGG - Intergenic
1024797666 7:53037390-53037412 GTTAGCACTGGGAAAGGGGAAGG + Intergenic
1025611665 7:63080215-63080237 GTTGACACAGGGAAGGAGGTGGG + Intergenic
1026043200 7:66886189-66886211 GATAAAACTGGGAAGATGAGTGG - Intergenic
1026861714 7:73794462-73794484 GGCAATATTGGGAAGGTGGGAGG - Intergenic
1027205206 7:76092304-76092326 GATAAAACTGGGAAGGTGAGCGG + Intergenic
1028105963 7:86879178-86879200 TTTAAAACTGGGAAAGAGGGGGG - Exonic
1029073541 7:97918983-97919005 GGTAACACTGGGAAGGGTTGGGG - Intergenic
1029123397 7:98282357-98282379 GTAGACCCTGGGATGGTGGGTGG - Exonic
1029202434 7:98848022-98848044 GTTAACACTGAGATGGGGTGGGG + Exonic
1033627030 7:143120381-143120403 GTTAACACTGGTCAGCTGCGAGG + Intergenic
1034539611 7:151748415-151748437 GGGAAAACTGGGAAGGTGTGGGG + Intronic
1035168970 7:157007451-157007473 GAAAACATTTGGAAGGTGGGAGG - Intronic
1035247922 7:157576940-157576962 GTTAACACTGGGAAGGTGGGAGG - Intronic
1035531609 8:356643-356665 GTCAACACCGAGAAGGAGGGAGG + Intergenic
1036244155 8:7102317-7102339 GGTAACACTGGGAAGGGTTGGGG + Intergenic
1036768828 8:11565292-11565314 GTCAACACTGACAAGCTGGGTGG - Intergenic
1036890068 8:12590943-12590965 GGTAACACTGGGAAGGGTTGGGG - Intergenic
1036897678 8:12649100-12649122 GGTAACACTGGGAAGGGTTGGGG - Intergenic
1040964941 8:53073706-53073728 GTTACAACTGAGAAGGTGTGAGG + Intergenic
1041409189 8:57534595-57534617 ATTAACACTGCAGAGGTGGGTGG + Intergenic
1041862413 8:62529572-62529594 GCTTACAGTGAGAAGGTGGGAGG + Intronic
1045069020 8:98480740-98480762 GATTTCACTGGGAGGGTGGGAGG - Intronic
1047593445 8:126351682-126351704 GTTAACACTGGGTGGGTGGGTGG + Intergenic
1053462283 9:38280322-38280344 GGTGACACTGGGAAGGTAGGAGG - Intergenic
1056761193 9:89416149-89416171 GTTAGTGCTGGGAAGGTGTGGGG + Intronic
1057321180 9:94014440-94014462 GTTAACAGGGGGAGGGAGGGAGG - Intergenic
1058700994 9:107600068-107600090 GTTAGCTCTGAGAGGGTGGGAGG + Intergenic
1058893882 9:109383608-109383630 GTTAACCCTGGACAGGTGGACGG + Intronic
1059038591 9:110787589-110787611 TTTTACACAGGGGAGGTGGGAGG + Intronic
1059343267 9:113611695-113611717 GGACACACTGGGATGGTGGGTGG + Intergenic
1060859429 9:126942088-126942110 CTCAACACTCGGAAGATGGGTGG - Intronic
1061674041 9:132205582-132205604 CTTAACAATGGTAAGGTGGCTGG + Intronic
1185855850 X:3534341-3534363 GTTAACACTGGGAAGTGTGCTGG + Intergenic
1187249416 X:17583399-17583421 GTAAACACCTGGAAGTTGGGAGG - Intronic
1188065259 X:25651276-25651298 GTTACCACTTGGGAGGTGTGAGG - Intergenic
1188524592 X:31075344-31075366 GTTAACCCTGGGAAAGAGGTAGG + Intergenic
1188947721 X:36327938-36327960 ATAAACACTGTGAGGGTGGGAGG + Intronic
1189715164 X:43857675-43857697 GCTAGCACTCGGGAGGTGGGAGG - Intronic
1190914877 X:54803936-54803958 GTTCACAAGGAGAAGGTGGGAGG + Intergenic
1191671317 X:63751245-63751267 ATTTACAGTGGGGAGGTGGGAGG + Intronic
1192452694 X:71253692-71253714 GTAAAGACTGGGGAGCTGGGGGG - Intronic
1192534227 X:71913652-71913674 GAGAAACCTGGGAAGGTGGGAGG + Intergenic
1192554196 X:72077244-72077266 TTCAACAGTGGGGAGGTGGGGGG - Intergenic
1193096320 X:77553523-77553545 GTAAAGACTGGAAAGGTAGGTGG - Intronic
1194436287 X:93872175-93872197 GTTGACTCTGGGAAAGTGGCTGG + Intergenic
1197891840 X:131276885-131276907 GCCAACCCTGGGATGGTGGGTGG - Intronic
1197893480 X:131288010-131288032 GCTAACACTGGGTAGGATGGAGG + Intronic
1199232122 X:145448292-145448314 GTTAGCACTGGGAAGGTAAAAGG + Intergenic
1199942637 X:152640154-152640176 ATTAAAGCTGGGAAGGTGGGGGG + Intronic
1201544185 Y:15142606-15142628 TTGGACACTTGGAAGGTGGGAGG - Intergenic