ID: 1035248244

View in Genome Browser
Species Human (GRCh38)
Location 7:157579604-157579626
Sequence CCGGGTCCCCCCAGTCGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 29}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035248244_1035248257 29 Left 1035248244 7:157579604-157579626 CCCCGTCGACTGGGGGGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1035248257 7:157579656-157579678 CGCGTCCGCCCTTCATTATGGGG No data
1035248244_1035248256 28 Left 1035248244 7:157579604-157579626 CCCCGTCGACTGGGGGGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1035248256 7:157579655-157579677 TCGCGTCCGCCCTTCATTATGGG 0: 1
1: 0
2: 0
3: 1
4: 15
1035248244_1035248255 27 Left 1035248244 7:157579604-157579626 CCCCGTCGACTGGGGGGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1035248255 7:157579654-157579676 CTCGCGTCCGCCCTTCATTATGG No data
1035248244_1035248252 2 Left 1035248244 7:157579604-157579626 CCCCGTCGACTGGGGGGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1035248252 7:157579629-157579651 GGCCTGGAAGCCGCACTCATTGG 0: 1
1: 0
2: 0
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035248244 Original CRISPR CCGGGTCCCCCCAGTCGACG GGG (reversed) Intronic
900311550 1:2035789-2035811 TGGGGTCCCCCCAGTCAGCGTGG - Intergenic
900311568 1:2035837-2035859 TGGGGTCCCCCCAGTCAGCGTGG - Intergenic
903220988 1:21869654-21869676 CCTGGTCCCCCAGGTGGACGAGG - Intronic
914748439 1:150515861-150515883 CTGGGTCGCCCCAGCCCACGGGG + Intergenic
1076849953 10:133087892-133087914 CCGGGTCCCCGCTGTCGCCGCGG + Exonic
1077143907 11:1036420-1036442 CCGGGTCCCCCCAGCAGCCGCGG - Intronic
1079407637 11:20160050-20160072 CCGGGTCCCGGCAGCCGACGGGG - Exonic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1098320588 12:69239719-69239741 CCAGGTCCCCGCCGCCGACGCGG + Intronic
1104890826 12:132139341-132139363 CCGGGGCCCCACAGACGATGAGG - Intronic
1130969044 15:88718073-88718095 CCAGGGCCCCCAAGCCGACGCGG - Intergenic
1130992837 15:88886875-88886897 CCTGGTCCCCCCAGTGGAAAGGG - Intronic
1132724638 16:1333518-1333540 CCGGGTCCCCTAAGGCGCCGTGG + Intergenic
1132934894 16:2475225-2475247 CCGGGTCCCCGCTGTCACCGCGG + Intronic
1141214059 16:82007987-82008009 CCGGGTCCCTCCAGGACACGTGG - Intronic
1141712869 16:85710115-85710137 CCGGGCCCCCACAGCCGACCCGG + Intronic
1147150338 17:38510468-38510490 CCGGGGCCGCCCAGACGGCGAGG + Exonic
1157321268 18:46636447-46636469 CCAGTTCCCTCCACTCGACGAGG + Intronic
1160586695 18:79917226-79917248 CCACGTCCCCCCAGCTGACGGGG + Intronic
1160684027 19:425175-425197 CCGGGGCCCCCCGGACCACGAGG - Exonic
1161085245 19:2332191-2332213 CCCGGTCCCCACAATCGACTGGG - Intronic
1166123412 19:40699478-40699500 CCAGGTCCCCCCACTGGACTGGG + Intronic
936872360 2:117147703-117147725 CTGGGTCCCCCCAGGATACGTGG + Intergenic
947384255 2:229575532-229575554 CCTGGTCCCCCCAATGGACCTGG - Intronic
948991752 2:241559119-241559141 CCGGGTCCTGGCAGTCGCCGTGG + Intronic
949050614 2:241895635-241895657 CCGGTTCTCCCCAGGCCACGAGG - Intronic
1175873912 20:62220594-62220616 CCGGGTCCCCACAGGCGCCAGGG - Intergenic
1178953773 21:37006240-37006262 GCAGGTCCCCCCAGTCCCCGAGG + Intronic
1006932456 6:37696443-37696465 CCGGGTCTCCCGAGCCGACCGGG + Intronic
1035202615 7:157276998-157277020 AATGGTCCCCCCAGTAGACGGGG - Intergenic
1035248244 7:157579604-157579626 CCGGGTCCCCCCAGTCGACGGGG - Intronic
1045259452 8:100559551-100559573 CCGGCTCCCTCCAGTCGCCGCGG + Intronic
1049206055 8:141364089-141364111 CCGGGTCCTGCCAGTGGACCTGG - Intronic
1185565713 X:1093658-1093680 CGGGGTCCCCCCAGTCAGTGGGG - Intergenic