ID: 1035252052

View in Genome Browser
Species Human (GRCh38)
Location 7:157604037-157604059
Sequence GGCTGTTCTCCGCCTTCAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 247}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035252048_1035252052 28 Left 1035252048 7:157603986-157604008 CCGGCAGTGCACTTACGATGGGG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1035252052 7:157604037-157604059 GGCTGTTCTCCGCCTTCAGCAGG 0: 1
1: 0
2: 1
3: 11
4: 247
1035252046_1035252052 29 Left 1035252046 7:157603985-157604007 CCCGGCAGTGCACTTACGATGGG 0: 1
1: 0
2: 1
3: 3
4: 43
Right 1035252052 7:157604037-157604059 GGCTGTTCTCCGCCTTCAGCAGG 0: 1
1: 0
2: 1
3: 11
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035252052 Original CRISPR GGCTGTTCTCCGCCTTCAGC AGG Exonic
901820136 1:11823688-11823710 GCCTGCTCTCCTCCATCAGCCGG + Exonic
902853350 1:19179718-19179740 GGCTGTTCTTCACCTCCAGGTGG + Intronic
907048816 1:51316117-51316139 GGCTGTTCTCAGGGTCCAGCAGG - Intronic
907904184 1:58769333-58769355 GGGTGTCGTCCGCCTTCAGAGGG - Intergenic
908044100 1:60149537-60149559 GGCTGATCTCAGCAGTCAGCAGG + Intergenic
908473638 1:64469254-64469276 GGCTGTTCTCCACACACAGCAGG + Intergenic
910869738 1:91822264-91822286 TGCTCTTCTCAGCCTACAGCGGG - Intronic
912114205 1:106384196-106384218 GCCTGTTCTCTACCTTCTGCTGG + Intergenic
913161845 1:116152243-116152265 GTCTGCTCTCTGCCTTCAGCGGG - Intergenic
916843355 1:168623421-168623443 GGCTCTTCTCTGCCACCAGCTGG + Intergenic
1062835659 10:634002-634024 GCCTGTTGTCCCCCTCCAGCAGG + Intronic
1067726423 10:48774502-48774524 GGTTCTTCTCCGACTTCACCAGG - Exonic
1067941241 10:50659063-50659085 GGCTGTTCTCCATCTCCCGCTGG - Intergenic
1070862463 10:79683935-79683957 GGCTGTTCTCCATCTCCCGCTGG - Intergenic
1071268068 10:83981981-83982003 GGGTCTTCTGAGCCTTCAGCAGG + Intergenic
1074820511 10:117174948-117174970 TGCTGTTCTCTGCCACCAGCAGG - Intergenic
1075748772 10:124746552-124746574 GGGTGTTCTCCGGCTTAATCAGG - Intronic
1076398340 10:130158108-130158130 GGTAGTTCTCAGCCTTCAGCAGG + Intronic
1076965344 11:77968-77990 GGCTGTTCTCCAGCCTCTGCTGG + Intergenic
1084268880 11:68018780-68018802 AGCTGGACTCCGCCTTCATCCGG + Exonic
1085908572 11:80794379-80794401 GGCTTTTCTGAGTCTTCAGCTGG - Intergenic
1088087972 11:106003914-106003936 GGCTGTTCTGAGGCATCAGCAGG + Intronic
1090665353 11:128911575-128911597 GGCTGTTCTTCGGCTTCATTTGG + Exonic
1091061485 11:132467142-132467164 GTCTGTTATCAGCCTGCAGCAGG - Intronic
1092103976 12:5907909-5907931 TGATGCTCTCAGCCTTCAGCAGG + Intronic
1094800044 12:34022664-34022686 TCCTCTTCTCCGCCTTCAGCCGG + Exonic
1095112835 12:38316958-38316980 TCCTCTTCTCCGCCTTCAGCCGG + Exonic
1095606770 12:44077155-44077177 AGCTTTTCACTGCCTTCAGCAGG - Intronic
1096155863 12:49341301-49341323 GGCTGTTCTCCGACTGCAGCTGG + Intergenic
1096915990 12:55034349-55034371 GGCTGTTCCCGGCCCTCAGTGGG - Intergenic
1103798765 12:123523561-123523583 GCTTGTTCTCCTCCTGCAGCTGG + Exonic
1104895254 12:132160817-132160839 GGCTGTCCTCCGACACCAGCTGG - Intergenic
1112615597 13:101001862-101001884 GGCTGTTCATGGCCTTCAGATGG + Intergenic
1113834071 13:113317298-113317320 CACTGTCCTCCGCCCTCAGCAGG + Intronic
1113916931 13:113879814-113879836 GGCTGTGCTCCCCCAACAGCTGG + Intergenic
1119830463 14:77697471-77697493 GGCTGTTCTGGGCCCACAGCTGG - Intronic
1121840779 14:97132077-97132099 GCCTGGTCTCTGCCTCCAGCTGG + Intergenic
1122366874 14:101199510-101199532 GGGGCTGCTCCGCCTTCAGCAGG - Intergenic
1122989335 14:105229632-105229654 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989360 14:105229734-105229756 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989384 14:105229836-105229858 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989409 14:105229938-105229960 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989434 14:105230040-105230062 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989459 14:105230142-105230164 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989483 14:105230244-105230266 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989507 14:105230346-105230368 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989532 14:105230448-105230470 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989557 14:105230550-105230572 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989582 14:105230652-105230674 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989607 14:105230754-105230776 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989632 14:105230856-105230878 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989657 14:105230958-105230980 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989682 14:105231060-105231082 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989707 14:105231162-105231184 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989732 14:105231264-105231286 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989757 14:105231366-105231388 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989782 14:105231468-105231490 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989807 14:105231570-105231592 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989831 14:105231672-105231694 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989856 14:105231774-105231796 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989881 14:105231876-105231898 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989906 14:105231978-105232000 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989929 14:105232080-105232102 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989953 14:105232182-105232204 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122989977 14:105232284-105232306 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990001 14:105232386-105232408 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990025 14:105232488-105232510 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990049 14:105232590-105232612 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990073 14:105232692-105232714 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990096 14:105232794-105232816 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990120 14:105232896-105232918 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990143 14:105232998-105233020 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990166 14:105233100-105233122 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990190 14:105233202-105233224 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990215 14:105233304-105233326 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990240 14:105233406-105233428 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990265 14:105233508-105233530 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990289 14:105233610-105233632 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990313 14:105233712-105233734 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990338 14:105233814-105233836 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990363 14:105233916-105233938 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990388 14:105234018-105234040 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990412 14:105234120-105234142 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990437 14:105234222-105234244 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990461 14:105234324-105234346 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990484 14:105234426-105234448 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990509 14:105234528-105234550 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990534 14:105234630-105234652 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990557 14:105234732-105234754 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990581 14:105234834-105234856 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990604 14:105234936-105234958 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990628 14:105235038-105235060 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990652 14:105235140-105235162 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990676 14:105235242-105235264 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990700 14:105235344-105235366 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990723 14:105235446-105235468 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990747 14:105235548-105235570 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990771 14:105235650-105235672 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990794 14:105235752-105235774 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990818 14:105235854-105235876 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990842 14:105235956-105235978 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990866 14:105236058-105236080 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990889 14:105236160-105236182 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990914 14:105236262-105236284 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990939 14:105236364-105236386 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990962 14:105236466-105236488 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122990986 14:105236568-105236590 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991010 14:105236670-105236692 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991034 14:105236772-105236794 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991058 14:105236873-105236895 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991082 14:105236975-105236997 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991106 14:105237077-105237099 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991130 14:105237179-105237201 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991154 14:105237281-105237303 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991179 14:105237383-105237405 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991202 14:105237485-105237507 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991225 14:105237587-105237609 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991249 14:105237689-105237711 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991273 14:105237791-105237813 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991296 14:105237893-105237915 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991320 14:105237995-105238017 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991344 14:105238097-105238119 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991369 14:105238199-105238221 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991393 14:105238301-105238323 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991417 14:105238403-105238425 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991441 14:105238505-105238527 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991465 14:105238607-105238629 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991489 14:105238709-105238731 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991513 14:105238811-105238833 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991537 14:105238913-105238935 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991561 14:105239015-105239037 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991586 14:105239117-105239139 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991610 14:105239219-105239241 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991634 14:105239321-105239343 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991659 14:105239423-105239445 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991682 14:105239525-105239547 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991705 14:105239627-105239649 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991729 14:105239729-105239751 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991753 14:105239831-105239853 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991777 14:105239933-105239955 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991801 14:105240035-105240057 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991825 14:105240137-105240159 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991849 14:105240239-105240261 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991873 14:105240341-105240363 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991896 14:105240443-105240465 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991920 14:105240545-105240567 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991944 14:105240647-105240669 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991967 14:105240749-105240771 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1122991991 14:105240851-105240873 GGCTGTCCCCCGCCCCCAGCTGG - Intronic
1202872457 14_GL000225v1_random:177324-177346 GGCTGCTCCCCGCCCTCCGCGGG + Intergenic
1123927828 15:25135504-25135526 GGCTATTCTCTGCTTTCAGAAGG + Intergenic
1124374416 15:29121287-29121309 GGGTGTTCTCCTCATGCAGCCGG - Exonic
1133099144 16:3468680-3468702 CGCAGTTCTCCGCCTTCCGGAGG - Intronic
1139311240 16:66030048-66030070 GGCTGTTCTCCGCCTTCCAAAGG - Intergenic
1139957209 16:70698777-70698799 AGATGTTCTCCGCATTCAGCAGG + Exonic
1142006786 16:87693017-87693039 GGCTGTTCTCTGCCCCCTGCAGG + Intronic
1144481044 17:15629130-15629152 TGCGGTTCTCCTCCTGCAGCCGG + Exonic
1144782070 17:17813434-17813456 GGCTGGCCCCCGCCATCAGCCGG + Exonic
1144917321 17:18734923-18734945 TGCGGTTCTCCTCCTGCAGCCGG - Exonic
1145939423 17:28734812-28734834 GGATGGTCTCCTCCTCCAGCAGG - Exonic
1146458648 17:33026190-33026212 GGCTGTTCACCTCGTTGAGCAGG + Intronic
1150318285 17:64188185-64188207 GGCTGCTCTCCGCACTCTGCAGG + Exonic
1151389621 17:73777309-73777331 TGCTTTTCTCCGGCTCCAGCTGG + Intergenic
1151534077 17:74727556-74727578 TGCTGTGCTCCGCCTTTGGCTGG + Intronic
1152149478 17:78589958-78589980 GTCTGTTCTCAGCCCTCAGTAGG + Intergenic
1152419420 17:80184076-80184098 GGCTGTGGTCAGCCTCCAGCTGG - Exonic
1153229437 18:2922046-2922068 GCTTGTTCTCCGCCTTCCACAGG - Exonic
1155502795 18:26503950-26503972 GGATGTTCTCCTCTTTCTGCAGG + Intronic
1156908285 18:42381050-42381072 GGCTGTTCTGCAGCCTCAGCTGG - Intergenic
1158712138 18:59847315-59847337 GGCTGTTCTCTGCCCTGGGCAGG + Intergenic
1160642148 19:147598-147620 GGCTGTTCTCCAGCCTCTGCTGG + Intergenic
1161518877 19:4712633-4712655 GGCTGTTCTCAAGCTACAGCAGG - Intronic
1163386065 19:17001405-17001427 GGCTGCTCCCCGCCCTCTGCAGG - Intronic
1165733901 19:38163873-38163895 AGGTGTTCTCAGCCTTCTGCTGG + Intronic
1166705435 19:44905674-44905696 GGCTGTTCTCCCCCTGCCCCAGG - Intergenic
1166781728 19:45346699-45346721 GGCGCTTCTCCTCCTCCAGCTGG - Exonic
1168388470 19:55986527-55986549 GGATGCTCACAGCCTTCAGCTGG - Intronic
925266277 2:2568768-2568790 AACAGTTCTCCACCTTCAGCAGG - Intergenic
939284059 2:140106109-140106131 GGCTGTTCTCCCACTTAAGTGGG + Intergenic
943107764 2:183568117-183568139 GGCTGATATCCCCTTTCAGCTGG - Intergenic
946195739 2:218032320-218032342 GGCTGTCCTCCTCCTTCTCCTGG - Intergenic
946355879 2:219184318-219184340 TCATGTCCTCCGCCTTCAGCTGG + Exonic
947904892 2:233753869-233753891 GTCTGTCCTCAGCCTTCAGAAGG + Intronic
1171008876 20:21495849-21495871 GGCTGTTCTAGGCCTGCAGTGGG + Intergenic
1171299358 20:24046107-24046129 GGCTGTCCTCCGCCTGCCGTGGG - Intergenic
1171516776 20:25744821-25744843 GGCAGTCCTCCACTTTCAGCTGG + Intergenic
1172744369 20:37195110-37195132 GGCAGTTTTCAGCCTTCAGTCGG + Intronic
1173826276 20:46049697-46049719 GGCCCTTCCCCGCCTTCAGCTGG - Exonic
1174332180 20:49829173-49829195 GGCTGGTATCCTCCTTCACCAGG + Intronic
1175232139 20:57480770-57480792 TGCTTTTCTACGCCTTCAGAAGG + Intergenic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1175811951 20:61863266-61863288 GGCTGTTCCTCACCTGCAGCCGG + Intronic
1176289568 21:5036958-5036980 GGCTGTTCCTCGGCTTCAGCGGG + Intronic
1177354729 21:19994214-19994236 AGCTGTTTTCCCCATTCAGCTGG + Intergenic
1178391678 21:32204060-32204082 GGCTTCTCTACACCTTCAGCTGG - Intergenic
1179867662 21:44226629-44226651 GGCTGTTCCTCGGCTTCAGCGGG - Intronic
1181023870 22:20116913-20116935 GGCGGTTCTCCGCCTAGACCAGG + Exonic
1181696455 22:24595118-24595140 GGCAGTTCTCTGCCTTCCACAGG - Intronic
1183087171 22:35493532-35493554 GGCTGTTTTCCCCTCTCAGCTGG + Intergenic
1183242244 22:36666744-36666766 GGCTCTTCACTGCCTTCAGAGGG + Intronic
1184171860 22:42764770-42764792 AGCCGTTCTCTGCCTTCAGAAGG - Intergenic
1185116168 22:48939599-48939621 GGCTGGTCCCTGCCTTCCGCTGG - Intergenic
949365115 3:3272307-3272329 GCCTGCTCTCCCCCTTTAGCTGG + Intergenic
951469030 3:23035726-23035748 GGCTGTTCTGCAGCTTCTGCTGG - Intergenic
956802018 3:72768227-72768249 AGCTCTTCTCTGCCTGCAGCAGG - Intronic
958586332 3:96091998-96092020 TGCTGTTCTGCGGCCTCAGCTGG + Intergenic
963018399 3:140848094-140848116 AGCTGATCTCCCCCTTCTGCTGG + Intergenic
964079019 3:152728529-152728551 ATCTGTTCTCCTCCTCCAGCTGG - Intergenic
965495045 3:169388088-169388110 AGCTGTTCTCCTCCTAGAGCAGG - Intronic
968660685 4:1797611-1797633 GCCTGTTCTCGGCCTTCTGGGGG + Intronic
968898400 4:3418592-3418614 GGCTGCTCCCCGCCTGCAGGGGG + Intronic
977045522 4:92064504-92064526 GGCTGTTCTTGGTCTACAGCTGG - Intergenic
980323855 4:131315171-131315193 CGCTATTCTCCTCCCTCAGCTGG + Intergenic
983748458 4:171231773-171231795 GCCTGGTCTCTGCCTTCATCAGG + Intergenic
985714753 5:1449244-1449266 TGTTGTTCTCCGACTTTAGCTGG + Intergenic
989567599 5:42916497-42916519 GTCTGTTCCCTGCCTTCATCTGG - Intergenic
989584130 5:43061339-43061361 GGTTGTTCTCTGCTCTCAGCAGG - Intergenic
990410255 5:55534746-55534768 GGCTGCTCTCCTCCTCCGGCTGG - Exonic
991360457 5:65814301-65814323 GTCTGTTCACAGCCCTCAGCTGG + Intronic
994151004 5:96447397-96447419 GGCTATTCTGTGCCTTCTGCTGG - Intergenic
994329770 5:98491062-98491084 GGATGTTTTCCTTCTTCAGCTGG - Intergenic
997688988 5:135812934-135812956 GCCTCTTCTCCACCTGCAGCTGG - Intergenic
1001951497 5:175819850-175819872 GGATGTTCTCAGCCTGAAGCAGG + Intronic
1002182230 5:177436547-177436569 GGCTGGGCCCCGCCCTCAGCAGG - Intronic
1002749813 6:97236-97258 GGCTGTTCTCCAGCCTCTGCTGG + Intergenic
1008628123 6:53337454-53337476 TGGTGTTCTACTCCTTCAGCTGG + Intronic
1013572878 6:111447643-111447665 GGCTGTTGTCATGCTTCAGCAGG - Intronic
1017681593 6:156870044-156870066 GGCTGTTCTCTGCCTTTGCCAGG + Intronic
1019238973 6:170649204-170649226 GGCTGTTCTCCAGCCTCTGCTGG - Intergenic
1019920093 7:4157856-4157878 GGCGGGTCTCTGCCTGCAGCCGG + Intronic
1020002250 7:4762542-4762564 GGCTGTTCTCCTCCGTCTGTGGG - Exonic
1020748479 7:12109828-12109850 GTCAGTTCTCAGCCTTCAGTGGG - Intergenic
1026494820 7:70893124-70893146 GGCTCTTCTCTGCCTGCTGCAGG + Intergenic
1029862609 7:103589710-103589732 GGCTGTTACCCGGCTTCTGCAGG - Exonic
1034098755 7:148433934-148433956 GGCTGTCCACAGCCTTCTGCTGG + Intergenic
1035252052 7:157604037-157604059 GGCTGTTCTCCGCCTTCAGCAGG + Exonic
1035508797 8:157405-157427 GGCTGTTCTCCAGCCTCTGCTGG + Intergenic
1040334713 8:46410154-46410176 CACTTTTCTCCGCCTTCCGCAGG - Intergenic
1041728848 8:61044597-61044619 GGTTTTTCTCCTCCTTCAACTGG - Intergenic
1043483576 8:80676870-80676892 GCCTGTGCTCCGCCTCCTGCAGG - Intronic
1048105448 8:131403492-131403514 CGCTGATCTCCTCCCTCAGCTGG - Intergenic
1048281225 8:133106814-133106836 GGCTGTTCTCTGCCTGCATGGGG - Intronic
1049402339 8:142434034-142434056 GGCTGTTCTGTGCCTTCAGGTGG + Intergenic
1051451650 9:17204493-17204515 TGCTGTTCTCCAGCCTCAGCTGG - Intronic
1052755211 9:32533906-32533928 GGCTGATCTAAGCCTTCACCTGG - Intergenic
1053156940 9:35787839-35787861 GGCTGTTCTCTGCCCTCTGTTGG + Intergenic
1055452668 9:76444799-76444821 GCCTGTTCCTTGCCTTCAGCAGG - Intronic
1057524547 9:95786848-95786870 GGCTGTTCTCCTCCTTGACTTGG + Intergenic
1057559631 9:96117035-96117057 GGCTGAGCTCTGTCTTCAGCTGG - Intergenic
1059797462 9:117714438-117714460 GGGTCTTCTCCACCTTCTGCAGG - Exonic
1060877509 9:127093846-127093868 TGGTGTTCTCCGGCTTCACCAGG + Exonic
1062395224 9:136350091-136350113 GGCTCTTCCCAGCCTTCAGGTGG + Intronic
1062474239 9:136719564-136719586 GCCTGTTCCCCGCCTGCAGCAGG - Intronic
1062759178 9:138329494-138329516 GGCTGTTCTCCAGCCTCTGCTGG - Intergenic
1203731993 Un_GL000216v2:99218-99240 GGCTGCTCCCCGCCCTCCGCGGG - Intergenic
1203599628 Un_KI270748v1:267-289 GGCTGTTCTCCAGCCTCTGCTGG - Intergenic
1195616443 X:106916276-106916298 GGCCCTACTCCACCTTCAGCTGG - Intronic
1196310381 X:114157274-114157296 TGCTTTACTCTGCCTTCAGCAGG + Intergenic
1201544071 Y:15141320-15141342 GGATGTTCTCTGTCTTCATCAGG + Intergenic
1202039132 Y:20664555-20664577 GGCTGGTCTCCCACTTCTGCAGG + Intergenic