ID: 1035254120

View in Genome Browser
Species Human (GRCh38)
Location 7:157615284-157615306
Sequence CCACGCACACCGCTCTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035254120_1035254128 0 Left 1035254120 7:157615284-157615306 CCCTGCAAGAGCGGTGTGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1035254128 7:157615307-157615329 GTTGCGGCTGGGTCTGCGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 216
1035254120_1035254127 -1 Left 1035254120 7:157615284-157615306 CCCTGCAAGAGCGGTGTGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1035254127 7:157615306-157615328 GGTTGCGGCTGGGTCTGCGCTGG 0: 1
1: 0
2: 0
3: 17
4: 174
1035254120_1035254133 25 Left 1035254120 7:157615284-157615306 CCCTGCAAGAGCGGTGTGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1035254133 7:157615332-157615354 AGTGTAGGCTGCACTCTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 85
1035254120_1035254130 10 Left 1035254120 7:157615284-157615306 CCCTGCAAGAGCGGTGTGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1035254130 7:157615317-157615339 GGTCTGCGCTGGGGTAGTGTAGG 0: 1
1: 0
2: 0
3: 11
4: 126
1035254120_1035254131 23 Left 1035254120 7:157615284-157615306 CCCTGCAAGAGCGGTGTGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1035254131 7:157615330-157615352 GTAGTGTAGGCTGCACTCTCCGG 0: 1
1: 0
2: 0
3: 9
4: 76
1035254120_1035254132 24 Left 1035254120 7:157615284-157615306 CCCTGCAAGAGCGGTGTGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1035254132 7:157615331-157615353 TAGTGTAGGCTGCACTCTCCGGG 0: 1
1: 0
2: 0
3: 7
4: 98
1035254120_1035254129 1 Left 1035254120 7:157615284-157615306 CCCTGCAAGAGCGGTGTGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1035254129 7:157615308-157615330 TTGCGGCTGGGTCTGCGCTGGGG 0: 1
1: 0
2: 0
3: 13
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035254120 Original CRISPR CCACGCACACCGCTCTTGCA GGG (reversed) Intronic
900520864 1:3104928-3104950 CCAAGGACAGGGCTCTTGCAGGG + Intronic
920675930 1:208038742-208038764 CCATGCACACAACCCTTGCAGGG - Intronic
1071618008 10:87094315-87094337 CGACGCTCACCTCCCTTGCAGGG + Exonic
1073176221 10:101559261-101559283 CCAGGCTCTCCTCTCTTGCAGGG - Intergenic
1077465350 11:2731288-2731310 CCATGCACCCCACTGTTGCATGG + Intronic
1080207128 11:29743230-29743252 CCATGAACAACTCTCTTGCATGG - Intergenic
1096594899 12:52688711-52688733 CCACCCACACCTCTCTTCCTTGG + Intergenic
1096796483 12:54081235-54081257 CCACACGCACCGAGCTTGCAAGG + Intergenic
1097319013 12:58205017-58205039 CAGCCCACACCTCTCTTGCAAGG + Intergenic
1101611816 12:106299541-106299563 CCAAGCACAGGGCTCTTCCAAGG + Intronic
1103013465 12:117475920-117475942 CCACTCACACAGCTGTTGGAAGG - Intronic
1104647313 12:130506358-130506380 GCAGGCACACCGCTCCTGAATGG - Intronic
1113841913 13:113365300-113365322 CCCCGCCCCCCGGTCTTGCAAGG - Intergenic
1117653363 14:57929102-57929124 CCAGGCCCACCACCCTTGCAGGG - Intronic
1118110487 14:62712779-62712801 CCTCGCACAAAGCTCTTTCAAGG - Intronic
1119672460 14:76529987-76530009 CCACACACACTGCCCTTGCTTGG + Intergenic
1121932994 14:97990339-97990361 CCAAGCACACTGTTCTTCCACGG + Intergenic
1122862265 14:104587949-104587971 ACACCCACACAGCTCTGGCAGGG + Intronic
1130893985 15:88156605-88156627 CCACTCACACTGTGCTTGCAGGG - Intronic
1140543746 16:75785861-75785883 CCACTCAGACTGCTCTTGCTTGG - Intergenic
1142273662 16:89104439-89104461 CCACACTCACCGCTCTTGCCAGG + Intronic
1146057630 17:29589241-29589263 CCCCGCACAGCGCTCTTGCCAGG + Intronic
1147367141 17:39966425-39966447 CCACTCTCACCTCTCCTGCACGG - Exonic
1157599324 18:48884533-48884555 CCACGCACACCAGCCTTGCCAGG + Intergenic
1160801314 19:971069-971091 GCGTGCACACAGCTCTTGCAGGG - Intronic
1161759576 19:6161338-6161360 CCACGCCCACTTTTCTTGCAAGG - Intronic
1162681928 19:12351220-12351242 CCACACACACTGCTTTTACATGG + Exonic
1167622430 19:50567429-50567451 CCACGGCAACCGCTCTTGCCAGG + Intronic
928499841 2:31879198-31879220 CCACTGAAACTGCTCTTGCAAGG + Intronic
935561953 2:104568596-104568618 CCACACTCAGCGCTGTTGCATGG - Intergenic
937128691 2:119490684-119490706 CCACCCACACAGCTCTGCCACGG + Intronic
949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG + Intergenic
1171847948 20:30289250-30289272 CCACACGCACCGAGCTTGCAAGG + Intergenic
1180211600 21:46298105-46298127 CCACGGACACCGCTCTAGCCAGG + Intergenic
1182518162 22:30870691-30870713 CCACCCCCACCGCCCTGGCACGG + Intronic
951629702 3:24706237-24706259 CCAGGCACACTGCAGTTGCAAGG - Intergenic
962809088 3:138946601-138946623 CCACCCCCACCGCCCTTGCCTGG + Exonic
974556224 4:63452036-63452058 CCACGCTCACAGCTCTATCATGG + Intergenic
977736602 4:100424614-100424636 CCACCCACAGATCTCTTGCATGG - Intronic
978084899 4:104639484-104639506 ACACACACACCCCTATTGCAGGG + Intergenic
984471776 4:180184935-180184957 GCACGCTCACCTCTCTTGGATGG - Intergenic
992424999 5:76648000-76648022 CCTCTCACACCACTCTAGCAGGG - Intronic
1017744300 6:157433044-157433066 ACAGGCACACCGCTCTTGGGCGG - Intronic
1019494282 7:1330442-1330464 CCACGCAGATCACTCTGGCAGGG + Intergenic
1035254120 7:157615284-157615306 CCACGCACACCGCTCTTGCAGGG - Intronic
1052116107 9:24649825-24649847 CCAGGCACACAGCTGTGGCAGGG - Intergenic
1053786083 9:41653900-41653922 CCACACGCACCGAGCTTGCAAGG + Intergenic
1054174800 9:61867841-61867863 CCACACGCACCGAGCTTGCAAGG + Intergenic
1054449656 9:65396894-65396916 CCACACGCACCGAGCTTGCAAGG + Intergenic
1054662740 9:67712952-67712974 CCACACGCACCGAGCTTGCAAGG - Intergenic
1059914008 9:119078216-119078238 CCACCTACACCCCCCTTGCATGG + Intergenic
1194828094 X:98587994-98588016 CCATGTACATCCCTCTTGCATGG + Intergenic
1197753478 X:129980634-129980656 CCACCCACCCCGCCCTTGCCTGG - Intergenic