ID: 1035254400

View in Genome Browser
Species Human (GRCh38)
Location 7:157617058-157617080
Sequence AGTCTGGATTTCAGCTCTGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035254398_1035254400 -2 Left 1035254398 7:157617037-157617059 CCTATGAGGATGGCACTGGGGAG 0: 1
1: 1
2: 1
3: 29
4: 194
Right 1035254400 7:157617058-157617080 AGTCTGGATTTCAGCTCTGACGG 0: 1
1: 0
2: 3
3: 33
4: 204
1035254392_1035254400 8 Left 1035254392 7:157617027-157617049 CCCAAGACAGCCTATGAGGATGG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1035254400 7:157617058-157617080 AGTCTGGATTTCAGCTCTGACGG 0: 1
1: 0
2: 3
3: 33
4: 204
1035254394_1035254400 7 Left 1035254394 7:157617028-157617050 CCAAGACAGCCTATGAGGATGGC 0: 1
1: 0
2: 0
3: 13
4: 106
Right 1035254400 7:157617058-157617080 AGTCTGGATTTCAGCTCTGACGG 0: 1
1: 0
2: 3
3: 33
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035254400 Original CRISPR AGTCTGGATTTCAGCTCTGA CGG Exonic