ID: 1035255911

View in Genome Browser
Species Human (GRCh38)
Location 7:157627197-157627219
Sequence GCGTGAGCTCCTGGTGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 339}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035255897_1035255911 22 Left 1035255897 7:157627152-157627174 CCAGGCACCAGTGTGCACCGCAC 0: 1
1: 0
2: 0
3: 8
4: 122
Right 1035255911 7:157627197-157627219 GCGTGAGCTCCTGGTGGTCAGGG 0: 1
1: 0
2: 1
3: 36
4: 339
1035255901_1035255911 5 Left 1035255901 7:157627169-157627191 CCGCACCTGCAGCTGGGTCTCCT 0: 1
1: 0
2: 6
3: 44
4: 428
Right 1035255911 7:157627197-157627219 GCGTGAGCTCCTGGTGGTCAGGG 0: 1
1: 0
2: 1
3: 36
4: 339
1035255898_1035255911 15 Left 1035255898 7:157627159-157627181 CCAGTGTGCACCGCACCTGCAGC 0: 1
1: 0
2: 1
3: 20
4: 157
Right 1035255911 7:157627197-157627219 GCGTGAGCTCCTGGTGGTCAGGG 0: 1
1: 0
2: 1
3: 36
4: 339
1035255896_1035255911 25 Left 1035255896 7:157627149-157627171 CCTCCAGGCACCAGTGTGCACCG 0: 1
1: 0
2: 0
3: 11
4: 169
Right 1035255911 7:157627197-157627219 GCGTGAGCTCCTGGTGGTCAGGG 0: 1
1: 0
2: 1
3: 36
4: 339
1035255903_1035255911 0 Left 1035255903 7:157627174-157627196 CCTGCAGCTGGGTCTCCTCCGGG 0: 1
1: 0
2: 0
3: 26
4: 271
Right 1035255911 7:157627197-157627219 GCGTGAGCTCCTGGTGGTCAGGG 0: 1
1: 0
2: 1
3: 36
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035255911 Original CRISPR GCGTGAGCTCCTGGTGGTCA GGG Intronic
900476670 1:2879391-2879413 CCCTGAGTTCCTGGTGGCCAAGG + Intergenic
900507312 1:3036211-3036233 GTGAGAGCTCCTGGTTGTTAAGG - Intergenic
901012720 1:6210467-6210489 GGGTGGGCTCCTGGTGGGGAGGG - Intronic
901055323 1:6446468-6446490 GCTTGAGCTCCTGGGGGAAAGGG + Intronic
901139289 1:7018044-7018066 GCTTGAGCCCTTGGAGGTCAAGG - Intronic
901448448 1:9322126-9322148 GACTTAGCTCCTGGTGGTCGAGG + Intronic
901657264 1:10776633-10776655 GCGGGAGCTCCTGGGAGTCCTGG + Intronic
901670854 1:10855723-10855745 GGGTGAGCTCCTTGCGGGCAGGG + Intergenic
901885169 1:12217731-12217753 GTGTCAGCTCCAGGTGGACAGGG - Intergenic
902479041 1:16702121-16702143 GCTTGAGCTCCTGGGGGAAAGGG - Intergenic
902602450 1:17549487-17549509 TCGTTAGCTGCAGGTGGTCAGGG + Intronic
902719261 1:18293150-18293172 CCGTGAGCTCCAGGAGGACAAGG + Intronic
903136469 1:21312531-21312553 GCTTGAGCTCAGGGAGGTCAAGG + Intronic
903663255 1:24991467-24991489 CCGTGAGCTCCTAGAGGGCAGGG + Intergenic
903706954 1:25292951-25292973 GCGTGAGGTCCTGGAAGGCAAGG + Intronic
903720284 1:25400396-25400418 GCGTGAGGTCCTGGAAGGCAAGG - Intronic
905106132 1:35564614-35564636 GAGTGGGCTCCTGGTGTACAGGG - Intronic
905198556 1:36300599-36300621 GACTGAGCTCCTGGAGGCCATGG + Intronic
906660753 1:47579691-47579713 TTCTGAGCTCCTGGTAGTCAAGG + Intergenic
906876123 1:49541381-49541403 GCATGAGTTCCAGGTGGGCATGG + Intronic
909475373 1:76075260-76075282 GCGTGAGTTGCTGGTGGTGAGGG + Intronic
911361116 1:96877516-96877538 GTGTGAGCTCCTTGGGGGCAGGG + Intergenic
911637940 1:100256491-100256513 GCGTGAGCCCCAGGAGGTCAAGG + Intergenic
911853922 1:102853823-102853845 GCGCCAGTTCCGGGTGGTCACGG + Intergenic
912468942 1:109893410-109893432 GTGTGAGCTCCAGGAGGACAGGG - Intergenic
913468986 1:119171595-119171617 GCGTGAGTTCCAGGTGGGCATGG + Intergenic
914857839 1:151365188-151365210 GCCAGAGCCCCTAGTGGTCAAGG - Exonic
915253242 1:154605573-154605595 TGGTGAGCTCTTGGGGGTCAAGG + Intronic
917406242 1:174711150-174711172 GCGTGAGTTCCGGGTGGGCGTGG - Intronic
917484994 1:175447761-175447783 GCCTTAGCTCCGTGTGGTCAGGG + Intronic
918002218 1:180508649-180508671 GCGTGAGTTCCAGGAGGGCATGG + Intergenic
918512030 1:185321994-185322016 GCGCGAGTTCCGGGTGGGCATGG - Intergenic
919049812 1:192499373-192499395 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
919418354 1:197340048-197340070 TTGTGAGCTCCTTGAGGTCAGGG - Intronic
919739988 1:200975501-200975523 GGATGAGCTCCTGCTGGTCTAGG + Exonic
919779991 1:201215576-201215598 GAGAGAGCCACTGGTGGTCAAGG + Exonic
920512937 1:206564274-206564296 GGGTGAGTTCCAGGTGGTCCTGG - Intronic
921572871 1:216799485-216799507 TTGTGAGCTCCTGGAGGTCAAGG - Intronic
924044203 1:240011172-240011194 CTGTGAGCTCCTGGAGGACAAGG + Intergenic
924305922 1:242689475-242689497 GCGTGAGTTCTGGGTGGGCATGG + Intergenic
1062973844 10:1668880-1668902 CTGTGAGCTCCTGGTGGCAAAGG + Intronic
1063322196 10:5060954-5060976 GCGTGAGTTCCAGGTGGGCATGG - Intronic
1063450392 10:6146317-6146339 GCGTGGGCTCCTGGCGGTGAAGG + Exonic
1064448402 10:15418358-15418380 GCTTGAGCTCGGGGGGGTCAAGG - Intergenic
1065095330 10:22274972-22274994 ACTTGAGCCCCTGGAGGTCAAGG + Intergenic
1065590294 10:27256527-27256549 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
1066648481 10:37634520-37634542 GCGTGAGTTCCAGGTGGGCGCGG + Intergenic
1067013270 10:42734472-42734494 GCTTGAGCCCATGGAGGTCAAGG + Intergenic
1067265017 10:44734277-44734299 GAGTGTCCACCTGGTGGTCAGGG - Intergenic
1068611608 10:59066495-59066517 GTGTGAGCTTCTGGAAGTCAGGG - Intergenic
1069642301 10:69963785-69963807 GGGTGTGCTCCTGGTGGTTCTGG - Intronic
1070380599 10:75877465-75877487 GTGTGAGCTCCTGGGTGGCATGG + Intronic
1070458831 10:76644546-76644568 GATTGAGCTCCTGGAGGTCAGGG - Intergenic
1071078698 10:81784266-81784288 GCGTGAGTTCTGGGTGGGCATGG + Intergenic
1071632522 10:87228778-87228800 CCGTGAGCCCCTTGTGGCCATGG - Exonic
1071645971 10:87360996-87361018 CCGTGAGCCCCTTGTGGCCATGG - Exonic
1073436492 10:103519865-103519887 GCTTGAGCCCCGGGGGGTCAAGG - Intronic
1074704719 10:116120662-116120684 GCGTGGACTACTGGTGTTCAAGG + Intronic
1076290236 10:129340382-129340404 GCTTGAGATCCTGTTGGTGACGG - Intergenic
1076781100 10:132725023-132725045 GCGTGTGCTCCTGCTGGCCTGGG - Intronic
1077050800 11:565912-565934 CAGTGAGCTCCTGGTGGCCCTGG - Intergenic
1077756670 11:5037354-5037376 GGCTGAGGTCCTGGTGGCCATGG + Intergenic
1078449271 11:11428274-11428296 GAGTGAGCTCCTGGAGGACGTGG - Intronic
1078527152 11:12110141-12110163 GCGGAAGCTCAGGGTGGTCAAGG + Intronic
1080309958 11:30878368-30878390 ACGTGAGCCCCGGGAGGTCAAGG + Intronic
1080896288 11:36451142-36451164 GAGTGAGAACCTGCTGGTCATGG + Intronic
1084095684 11:66909634-66909656 ACGTGAGCTCCTGGAGGGCAGGG - Intronic
1084569685 11:69951847-69951869 GCTTGAGCTCCTGGGGCCCAGGG - Intergenic
1085618734 11:78021925-78021947 GAGTGAGCTTCTGGAGGTGAGGG - Intronic
1085863101 11:80257610-80257632 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
1086001633 11:81991190-81991212 GCGTGAGTTCCAGGTGGGCACGG - Intergenic
1088882080 11:113980317-113980339 CTGTGAGCTCATGGTGGGCAGGG - Intronic
1090133576 11:124170996-124171018 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
1090588237 11:128237138-128237160 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
1091289366 11:134428854-134428876 CAGTGAGCTCCTGGGGGGCAGGG - Intergenic
1091306709 11:134540947-134540969 GTGTGAGCTCCTGGTCGTGCTGG + Intergenic
1091605621 12:1949128-1949150 GAGTGGGCTGCTGGTGATCACGG + Exonic
1094405377 12:30110761-30110783 GCGGGAGTTCCGGGTGGGCAGGG - Intergenic
1094671895 12:32578745-32578767 GCTTGAGCCCCAGGAGGTCAAGG + Intronic
1094722037 12:33075393-33075415 GCGCGAGTTCCGGGTGGGCATGG + Intergenic
1095533953 12:43224370-43224392 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
1095751371 12:45715376-45715398 GTGTGAGCTCCTTGAGGACAAGG - Intergenic
1095961286 12:47835727-47835749 CCGTGAGCTCCTGGGGGTAGTGG - Intergenic
1097455014 12:59789108-59789130 CTGTGAGCTCCTTGTGGACAAGG + Exonic
1099192419 12:79573966-79573988 GCGCGAGTTCCGGGTGGGCATGG + Intergenic
1099443815 12:82728819-82728841 GCGCGAGTTCCAGGTGGGCATGG + Intronic
1100616989 12:96238470-96238492 GTGTGAGCTGCTGCTGGGCACGG + Intronic
1100949597 12:99831696-99831718 GCTTGAGCTCCTACTGATCAGGG + Intronic
1102387260 12:112520202-112520224 GCGCGAGTTCCTGGTGGGCGTGG - Intergenic
1104373852 12:128247291-128247313 GCGTGAGTTCCAGGTGGGCACGG + Intergenic
1105018205 12:132798937-132798959 GCCTGAGCACCTGGAGGTCTGGG - Intronic
1105701565 13:22938950-22938972 GCATGAGTTCCTGGTGGGCGCGG - Intergenic
1106840621 13:33682155-33682177 GTGTGAGTTCCGGGTGGGCACGG + Intergenic
1107836087 13:44413623-44413645 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
1108845641 13:54676618-54676640 GCGCGAGTTCCAGGTGGGCATGG + Intergenic
1109145384 13:58773365-58773387 GCGTGAGTTCTGGGTGGGCATGG + Intergenic
1109429392 13:62212394-62212416 GCGAGGGTTCCTGGTGGGCACGG - Intergenic
1109909766 13:68893698-68893720 GCGTGGGCTCCTAGAGCTCAGGG - Intergenic
1115268657 14:31527398-31527420 GCGCGAGCTCCGGGTGGGCGTGG - Intronic
1117082570 14:52166794-52166816 GCGTGAGGTCCAGGTGGGCGTGG + Intergenic
1118306308 14:64658226-64658248 GCGCGAGTTCCTGGTGGGCGTGG + Intergenic
1120887933 14:89466567-89466589 CTGTGGGCTCCTGGTGGGCAAGG - Intronic
1122087659 14:99318704-99318726 GAATGAGCCCCTGGAGGTCAGGG - Intergenic
1122165164 14:99817757-99817779 CCGTGAGCTCCTTGCAGTCAGGG - Intronic
1122894844 14:104751798-104751820 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
1123067967 14:105627764-105627786 GGGGCAGCTCCTGGAGGTCAGGG - Intergenic
1202903097 14_GL000194v1_random:54366-54388 AGGTGAGCTCCTGGAGGCCACGG - Intergenic
1124046503 15:26155643-26155665 GCCTGAGCCCCTAGTGGGCATGG - Intergenic
1124387868 15:29225059-29225081 GCGTGAGTTCTGGGTGGGCATGG - Intronic
1127279660 15:57478151-57478173 CCGTGGGCTCATGGTGTTCATGG + Intronic
1128737551 15:70061791-70061813 CCATGAGCTCCTGGAGGGCAGGG - Intronic
1129208614 15:74052586-74052608 GCGCGAGTTCCGGGTGGGCATGG + Intergenic
1131012728 15:89031966-89031988 GCGCGAGTTCCGGGTGGGCATGG - Intergenic
1131212670 15:90511007-90511029 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
1131227618 15:90638523-90638545 GGGTGAGCTCCTGGGGTGCAGGG - Exonic
1131912566 15:97224295-97224317 GCGCGAGTTCCGGGTGGGCACGG + Intergenic
1135256612 16:20946440-20946462 GCATGTGCCCCAGGTGGTCAGGG - Intronic
1137447138 16:48538812-48538834 CTGTGAGCTCCTCGTGGGCAGGG - Exonic
1137765445 16:50974285-50974307 CTGTGAGCTCCTGGAGGCCAAGG + Intergenic
1138691384 16:58771995-58772017 GCTTGAGCCCCAGGAGGTCAAGG - Intergenic
1139359349 16:66387942-66387964 GTGTGAGATCCTGGAGTTCAAGG + Intronic
1142269420 16:89081441-89081463 GCGTGAGCTCCTGGAGTTAGAGG + Intergenic
1142876858 17:2856506-2856528 GCCTGTGCTCCTGGTGACCAAGG + Intronic
1143128008 17:4656821-4656843 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
1143163198 17:4884767-4884789 GCTTGGGCTCCTGGTGGAGAAGG + Intronic
1143177630 17:4965543-4965565 GTATGAGCTCCTGGAGGGCAGGG + Intronic
1143508627 17:7383442-7383464 GGGTGGGCTCCTTGTGCTCAGGG - Exonic
1145094817 17:20016514-20016536 GCGTGAGTTCCCGGTGGGCGTGG + Intronic
1146027381 17:29333143-29333165 GCTTGAGCTCCAGGAGGTCGAGG - Intergenic
1147450025 17:40498638-40498660 GCTTGAGCCCCAGGAGGTCAAGG - Intronic
1148743183 17:49904368-49904390 GGGTGTGCTCCTGGGAGTCAGGG - Intergenic
1149916363 17:60613662-60613684 GCGCGAGTTCCAGGTGGGCATGG + Intronic
1151354681 17:73551323-73551345 GATTAAGCTCCTGGTGGGCAAGG - Intronic
1151538160 17:74750075-74750097 GAGAGAGCTCCTGGGGCTCACGG + Intronic
1151576638 17:74955758-74955780 GCCTGAGGCCCTGGTGGTCAGGG - Intronic
1151577153 17:74958583-74958605 GCCTGAGCTCCTGGGAGTCAGGG + Intronic
1151588913 17:75030366-75030388 GCGTGGGCTCCTGGCGCTCGGGG + Intergenic
1151617816 17:75225832-75225854 GAGTGAGCTCGGGGTGGGCAAGG + Intronic
1153395720 18:4618067-4618089 GCATCTGCTCCTGGTGGTCACGG - Intergenic
1153546230 18:6208029-6208051 GTGTGAGCCCATGGAGGTCAAGG + Intronic
1153557556 18:6331991-6332013 TTGTGAGCTCCTGGAGGTCAGGG - Intronic
1154012668 18:10589190-10589212 GCGTGGGCTCCAGGTGGCCCCGG + Intergenic
1155976758 18:32139913-32139935 GCGTGAGTTCCGGGTGGGCGTGG + Intronic
1157935205 18:51864682-51864704 GCGCGAGTTCCGGGTGGGCATGG - Intergenic
1159438414 18:68447127-68447149 TCATAAGCGCCTGGTGGTCAGGG - Intergenic
1161592708 19:5135953-5135975 GGGTGAGCTTCTGGGTGTCAGGG - Intronic
1161841637 19:6685077-6685099 GGTTCAGTTCCTGGTGGTCAGGG + Exonic
1161889028 19:7020200-7020222 GCGTGAGGTCTTGGTGAACAGGG - Intergenic
1161890337 19:7031813-7031835 GCGTGAGGTCTTGGTGAACAGGG + Intronic
1161891111 19:7038920-7038942 GCGTGAGGTCTTGGTGAACAGGG - Intronic
1161892426 19:7050549-7050571 GCGTGAGGTCTTGGTGAACAGGG + Intronic
1161893196 19:7057381-7057403 GCGTGAGGTCTTGGTGAACAGGG - Intronic
1163719392 19:18891507-18891529 GCCTGAGCTCCGGGTGGGCTGGG - Intronic
1164581946 19:29440068-29440090 GCGTGAGTTCCAGGTGGGCTTGG + Intergenic
1165174452 19:33917436-33917458 ACTTGAGCCCCTGGAGGTCAAGG - Intergenic
1165453129 19:35896614-35896636 GGGTGAGCTCCTGGGGCTGAGGG - Intronic
1166406883 19:42527836-42527858 GCGTGAGCTCCGTGAGGGCAGGG + Intronic
1166432528 19:42739556-42739578 GCGTGAGCTCCGTGAGGACAGGG + Intronic
1166435646 19:42764764-42764786 GCGTGAGCTCCATGAGGACAGGG + Intronic
1166445515 19:42854797-42854819 GCGTGAGCTCCGTGAGGACAGGG + Intronic
1166492072 19:43268626-43268648 GCGTGAGCTCCGTGAGGACAGGG + Intronic
1167603836 19:50469460-50469482 GTGGGAGCTCCTGGAGGGCAGGG + Intronic
1168569834 19:57457428-57457450 GTGTGGGCTCAAGGTGGTCATGG - Intronic
1202713082 1_KI270714v1_random:28028-28050 GCTTGAGCTCCTGGGGGAAAGGG - Intergenic
926241653 2:11093548-11093570 GAGTGAGCTCCTGGAGGCCAGGG - Intergenic
926246198 2:11123746-11123768 GGCTGATCTCCTGGTGATCAGGG + Intergenic
927596561 2:24402907-24402929 GCATGAGTTCCCGGTGGGCATGG + Intergenic
929066513 2:37980849-37980871 CGGTGAGCTCTTGGAGGTCAAGG + Intronic
929109849 2:38397359-38397381 GCGCGAGTTCCGGGTGGGCATGG + Intergenic
930201290 2:48554086-48554108 GTGTGAGCTCCTGGTTGTGCTGG + Intronic
931344340 2:61432391-61432413 GCTTGAGCCCCAGGAGGTCAAGG + Intronic
933139780 2:78779042-78779064 GCGCGAGCTCCCGGTGGGCGCGG + Intergenic
933511491 2:83246238-83246260 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
934774935 2:96931315-96931337 CCATGAGCTCCTTGAGGTCAAGG - Intronic
935538918 2:104326429-104326451 GTGGGAGCACCTGATGGTCAGGG + Intergenic
935878384 2:107536401-107536423 GCGTGAGTTCCTGGTGGGCATGG - Intergenic
936172724 2:110190505-110190527 GCGTGAGTTCCGGGTGGGCGTGG - Intronic
936437109 2:112517860-112517882 GCTTGAGCTCGGGGAGGTCAAGG + Intronic
937789453 2:125943237-125943259 GCGTGAGTTCCAGGTGGGCACGG - Intergenic
937825140 2:126360634-126360656 GCGTGAGCCACTGGTAGGCAGGG + Intergenic
938604984 2:132883117-132883139 GCTTGAGCCCCAGGAGGTCAAGG + Intronic
939454449 2:142415897-142415919 ACGTCAACTCCTTGTGGTCAAGG + Intergenic
940784625 2:157968183-157968205 GCGCGAGTTCCAGGTGGGCATGG - Intronic
941898856 2:170658426-170658448 GCTTGAGCCCCAGGAGGTCAAGG + Intergenic
945069620 2:205977278-205977300 GCGTGAGTTCCCAGTGGGCATGG + Intergenic
947786810 2:232830061-232830083 GCTTGAGCCCCTGGAGTTCAAGG - Intronic
948127203 2:235572859-235572881 GCGGGAGCTCCTGGTGTTGGGGG + Intronic
948231250 2:236351202-236351224 AGGTGGGCTCCTGGAGGTCAGGG - Intronic
948614824 2:239191655-239191677 ACCTGAGCTCCTGGTGCCCAGGG + Intronic
948865254 2:240771799-240771821 GGGTGAGCTCCTCGTGGTGGAGG - Intronic
948883104 2:240870324-240870346 GAGTGAGCTCCCGGGAGTCAGGG - Intronic
1168798826 20:630770-630792 CAGTGAGCTCCTGGAGGACAGGG + Intergenic
1171153237 20:22846455-22846477 GCATGAGTTCATGGTTGTCATGG + Intergenic
1171384940 20:24763704-24763726 GCCTGGGGTGCTGGTGGTCAGGG + Intergenic
1172524873 20:35594162-35594184 TCGTGAACTCCTGGGGCTCAAGG - Intergenic
1172671209 20:36635510-36635532 GCCTGTGCTCCGGGTGGGCATGG + Intronic
1172795379 20:37533369-37533391 CCGTGAGCTCTTGGAGGGCAGGG + Intergenic
1173703900 20:45096216-45096238 GAGAAAGCTGCTGGTGGTCAGGG + Intronic
1174038815 20:47684701-47684723 GTGTGATCTCCTGGTGGGAAAGG + Intronic
1174162906 20:48564375-48564397 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
1175225016 20:57439600-57439622 CCCTGAGCTCCTGGTGGTGCTGG + Intergenic
1175366384 20:58459220-58459242 GGGGGAGCTCCTGGTGGGGATGG - Exonic
1175630866 20:60535234-60535256 GCTTCAGCTCCTGCTGGACAGGG - Intergenic
1176065019 20:63190048-63190070 GCGTGAGCACCTGGAGGTGCAGG - Intergenic
1176622461 21:9069133-9069155 AGGTGAGCTCCTGGAGGCCACGG - Intergenic
1178074155 21:29000224-29000246 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
1178082236 21:29077430-29077452 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
1178125921 21:29515701-29515723 GCTTTATTTCCTGGTGGTCAAGG + Intronic
1178621259 21:34178709-34178731 GTGTGAGCTCCATGTGGGCAGGG - Intergenic
1180057800 21:45367878-45367900 GCGTTTGCTCCCGGTGGTCAAGG - Intergenic
1182259783 22:29065199-29065221 TCTTGAGCTCCTGTTGCTCATGG + Intergenic
1182686943 22:32128350-32128372 GGGTGAGCTCCTGGAGGACAGGG - Intergenic
1182714673 22:32348134-32348156 GGGTGAGCTCCTGGAGGACAGGG + Intergenic
1183779713 22:39991229-39991251 ATGTGAGCTCCGGGTGGGCAAGG + Intergenic
1184213537 22:43051407-43051429 GAGTGTGCTCCTGCTGGCCAAGG + Intronic
950106688 3:10393093-10393115 CTGTGAGCTCCTGGAGGGCAGGG - Intronic
950203574 3:11061430-11061452 GCGTGAGTTCCAGGTGGGCGTGG + Intergenic
950430991 3:12951025-12951047 CCTTGAACTCCTTGTGGTCAAGG - Intronic
950470146 3:13179803-13179825 GCGCGAGTTCCGGGTGGGCATGG + Intergenic
950528598 3:13539479-13539501 ATGTGAGCTCCATGTGGTCAGGG + Intergenic
950860189 3:16140906-16140928 GCATAAGCTCCTGATGGGCAGGG + Intergenic
952453669 3:33453497-33453519 GCGTGAGTTCCGGGTGGTTGTGG + Intergenic
952713291 3:36453393-36453415 GCGTGAGTTCCGGGTGGGCGTGG + Intronic
954226215 3:49182928-49182950 GCGTGAGTTCCGGGTGGGCATGG - Intronic
954590218 3:51776520-51776542 GGGTGTCCTGCTGGTGGTCAGGG - Intergenic
954989026 3:54822665-54822687 GTGTGGGTTCCTGGGGGTCATGG + Intronic
955240442 3:57173520-57173542 GAGTGAGTTCCTGGAGGGCAAGG - Intergenic
956692253 3:71889262-71889284 ATGTGATCTCCAGGTGGTCATGG - Intergenic
957056182 3:75444726-75444748 GCGCGAGTTCCGGGTGGGCATGG - Intergenic
957209455 3:77240396-77240418 GCGTGAGTTCCGGGTGGGCGTGG - Intronic
957529829 3:81426909-81426931 GAGTGAGCTCCTGGTGCCTATGG + Intergenic
958881985 3:99682332-99682354 GCTTGAGCCCTGGGTGGTCAAGG + Intronic
960669179 3:120140298-120140320 GCGAGAGTTCCGGGTGGGCATGG + Intergenic
962398777 3:135039741-135039763 GCTTGAGTTCCGGGTGGGCATGG - Intronic
962711946 3:138094852-138094874 GCGGCAGCTCCAGGTGGGCAGGG - Exonic
963819942 3:149879389-149879411 GCCTGAGCCCCAGGAGGTCAAGG - Intronic
963869452 3:150399258-150399280 GCCTGAGATTCTGGTGGTGATGG - Intergenic
964983178 3:162710822-162710844 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
965256763 3:166424023-166424045 GCGTGAGTTCTGGGTGGGCATGG + Intergenic
966183049 3:177204173-177204195 GCGTGAGTTCTGGGTGGGCATGG - Intergenic
966186180 3:177228892-177228914 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
966865360 3:184255921-184255943 GCATGAGCTCCTTGAGGGCAGGG + Intronic
967137873 3:186527909-186527931 TTGTGAGCTCCTTGAGGTCAAGG - Intergenic
967832483 3:193932227-193932249 TCGTGAGCTCCTAGAGGACAGGG + Intergenic
968465977 4:751482-751504 CCCTGAGCTCCTGCCGGTCACGG + Intronic
968569929 4:1334029-1334051 GGGTGAGCACATGGTGGGCATGG - Intronic
968569961 4:1334127-1334149 GGGTGAGCACATGGTGGGCATGG - Intronic
968998992 4:3965005-3965027 GCGTGAGTTCCGGGTGGGCATGG - Intergenic
969256619 4:6006843-6006865 CTGTGAGCTCCTTGAGGTCAGGG - Intergenic
969300022 4:6292219-6292241 GCGTGCGCTCCAGGTGGGCAGGG - Intronic
969608645 4:8215035-8215057 GTGTGCGCACCTGGTGCTCAGGG + Intronic
970093236 4:12432923-12432945 GCATGTGCCCATGGTGGTCAGGG - Intergenic
970402008 4:15726225-15726247 ACATGAGCTCCAGGAGGTCAGGG + Intronic
971280557 4:25239544-25239566 GCGCGAGTTCCGGGTGGGCATGG - Intronic
972344616 4:38182627-38182649 GCATGAGTTCCCGGTGGGCATGG + Intergenic
974089907 4:57300481-57300503 GCATGAGTTCCGGGTGGGCATGG - Intergenic
977138511 4:93337375-93337397 GTGTCACCTCCTGGTGGTGATGG - Intronic
977470728 4:97438397-97438419 GCATGAGTTCCGGGTGGGCATGG - Intronic
977612582 4:99051472-99051494 GCTTGAGCTCTCGGAGGTCAAGG - Intronic
977641143 4:99359723-99359745 GTGTGAGTTCCGGGTGGGCATGG + Intergenic
977883575 4:102234387-102234409 GTGTGAGTTCCGGGTGGGCAAGG + Intergenic
977885137 4:102245091-102245113 GCGTGAGTTCCGGGTGGGCACGG + Intergenic
978207854 4:106101092-106101114 CTGTGAGCTTCTGGTGGGCAGGG + Intronic
979445692 4:120808878-120808900 GCGTGAGTTCCAGGTGGGCGTGG - Intronic
979829332 4:125280997-125281019 GCGCGAGTTCCAGGTGGGCATGG + Intergenic
979949532 4:126874750-126874772 GCTTGAGCTCCAGGTGGGCATGG - Intergenic
980115195 4:128672711-128672733 GCGTGAGTTCCGGGTGGGCATGG + Intergenic
980239279 4:130152667-130152689 GCTTGAGCGCCTGGAGGTAATGG - Intergenic
980269127 4:130561780-130561802 ACTTGAGCCCCTGGAGGTCAAGG + Intergenic
982088303 4:151858680-151858702 GCGTGAGGTCCTTGTGGTGATGG - Intergenic
982263780 4:153519886-153519908 GTGTGAACTCCCTGTGGTCAAGG - Intronic
986274098 5:6258403-6258425 GCGTGGGCTCCAAGTGGGCAGGG + Intergenic
986720951 5:10561495-10561517 GCTTGAACTCCTGGGGCTCAAGG + Intergenic
986912557 5:12574786-12574808 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
987012643 5:13782947-13782969 GCGTGAGCTCCTGAGGGGCAGGG - Intronic
988020547 5:25614867-25614889 GCCTGAGTTCCAGGTGGCCACGG - Intergenic
988500108 5:31777152-31777174 GCGTGAGTTCCGGGTGGGCACGG + Intronic
989777361 5:45225682-45225704 GCGTGAGTTCCGGGTGCTCGCGG + Intergenic
990243235 5:53837020-53837042 GCGTGAGTTCTGGGTGGGCATGG + Intergenic
992050339 5:72935287-72935309 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
992567462 5:78013125-78013147 GCCTGAGCCCATGGAGGTCAAGG - Intronic
994210799 5:97085540-97085562 GCGCGAGTTCCGGGTGGGCACGG - Intergenic
995700338 5:114928885-114928907 GCGTGAGTTCCAGGTGGACGTGG + Intergenic
996478718 5:123949499-123949521 GCGGGAGTTCCGGGTGGGCATGG - Intergenic
996575914 5:124976409-124976431 GCATGAGTTCCTGGTGGTGGTGG - Intergenic
996747123 5:126854842-126854864 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
997352194 5:133239036-133239058 GCGTGAGTTTCGGGTGGGCATGG + Intronic
997375478 5:133394402-133394424 GCCTGAGTTCCAGGTGGGCATGG + Intronic
998178334 5:139915961-139915983 GCATGAGCTCCAGGTGCTCTGGG - Intronic
999470602 5:151851411-151851433 GCCGGAGCTCTGGGTGGTCATGG + Exonic
999640361 5:153666276-153666298 CTGTGAGCTCCTGGAGGGCAGGG - Intronic
1000212340 5:159119222-159119244 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
1002175757 5:177400243-177400265 GCGCGCGCTCCTGGTGCTAATGG - Exonic
1002655094 5:180739704-180739726 GTGTGTGCTCCTGGTGGTGATGG - Exonic
1002779798 6:357428-357450 ACCTGTGCTCCTGGTGGTCCTGG - Intergenic
1003897037 6:10617328-10617350 GCGTGAGTTCCGGGTGGGCGTGG - Intronic
1004599238 6:17131751-17131773 GCTTGAGCCCCAGGAGGTCAAGG - Intergenic
1004607394 6:17206749-17206771 GCGCGAGTTCCGGGTGGGCACGG - Intergenic
1004760139 6:18656879-18656901 GCCTGAGCCCCTAGGGGTCAGGG + Intergenic
1006377404 6:33679197-33679219 GTGTCAGCTCCTGGGGGGCACGG + Intronic
1009615517 6:65999677-65999699 GCGTGAGTTCCAGGTGGACGTGG - Intergenic
1011931780 6:92723547-92723569 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
1012850974 6:104446385-104446407 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
1013160393 6:107538420-107538442 GCCTGAGCTTCAGGTGGTCAGGG - Intronic
1013172192 6:107646767-107646789 CAGTGGGCTCCTGGTGGTGAAGG + Intronic
1018169891 6:161136430-161136452 GGGTGAGCCCCTGCTGGGCACGG - Exonic
1018424867 6:163671285-163671307 GCGTGGCCTCCAGGTGGTCCAGG + Intergenic
1018735114 6:166681864-166681886 GCAGGAGCTGCTGGTGGACAAGG - Intronic
1019308720 7:348531-348553 GGCTGAGCCCCTGGTGGTCCGGG + Intergenic
1019436097 7:1022989-1023011 ACGTGAGCTCCTGGAGGACAGGG + Intronic
1020552298 7:9621757-9621779 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
1020662219 7:10995838-10995860 GCGCGAGTTCCGGGTGGGCATGG - Intronic
1021567365 7:22028729-22028751 GCGTGAGTTCCGGGTGGGCGTGG + Intergenic
1021823118 7:24517892-24517914 GTGTAAGCTCCTTGAGGTCAAGG - Intergenic
1021944209 7:25709659-25709681 GCTTGAGCCCCAGGAGGTCAAGG + Intergenic
1023670700 7:42573128-42573150 GGGTGAGGACCTGGTGGTGAGGG + Intergenic
1030016766 7:105230399-105230421 GTGTGAGAGCCTGGTGGTTATGG - Intronic
1030443850 7:109624480-109624502 GCGTGGGCTCCCGGAGCTCAGGG - Intergenic
1030943384 7:115683410-115683432 CTGTGAGCTCCTGGAGGACAAGG - Intergenic
1031294404 7:119983634-119983656 GAGAGAGGTCCTGGTGGGCATGG - Intergenic
1031513335 7:122674140-122674162 GCGTGAGTTCCGGGTGGGCATGG - Intronic
1034100381 7:148445536-148445558 GCGTGAGTTCCGGGTGGTCGTGG - Intergenic
1034675196 7:152887909-152887931 GTGGGAGCTCCTGGAGGCCAGGG + Intergenic
1035219114 7:157395006-157395028 GCTTGAGCTGGTGGAGGTCAAGG + Intronic
1035255911 7:157627197-157627219 GCGTGAGCTCCTGGTGGTCAGGG + Intronic
1035564162 8:630189-630211 GAGTCAGCTCTGGGTGGTCACGG - Intronic
1035763851 8:2089893-2089915 GCGGGCGCGCCTGGTGGTCCTGG + Intronic
1036216000 8:6880310-6880332 ACATGTGCTCCAGGTGGTCAAGG - Intergenic
1036378244 8:8218942-8218964 GCGTGAGTTCCGGGTGGGCATGG + Intergenic
1036766241 8:11550963-11550985 GAGGGGGCTCCTGGTGGTCTGGG - Intronic
1038847623 8:31244417-31244439 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
1038921746 8:32092547-32092569 GCTTGAGCTCTTGGTTGCCATGG + Intronic
1039491549 8:37951470-37951492 ACCTGAGCTCTTGGAGGTCAAGG + Intergenic
1039587594 8:38719914-38719936 GCGCGAGTTCCGGGTGGGCATGG + Intergenic
1040000849 8:42575264-42575286 GCATGAGTTCCGGGTGGGCATGG + Intergenic
1040003720 8:42600373-42600395 GCGCGAGTTCCAGGTGGGCATGG - Intergenic
1040026527 8:42786824-42786846 GCGTGAGTTCCAGGTGGGCGTGG + Intronic
1040965600 8:53077939-53077961 GCGTGAGTTCCAGGTGGGCGCGG - Intergenic
1043429553 8:80181665-80181687 GCTTGAGCCCCGGGAGGTCAAGG + Intronic
1047551555 8:125878428-125878450 GAGAGAGCTCCTTGAGGTCATGG + Intergenic
1048456521 8:134583484-134583506 CCTTGAGCTCCAGGTGGTGATGG + Intronic
1049495062 8:142926202-142926224 GCGAGGGCTGCTTGTGGTCAGGG - Intergenic
1049552673 8:143267646-143267668 GGGTGGGCTCCTGGGGGTCGCGG + Intronic
1049857915 8:144875219-144875241 GCGTGAGTTCCGGGTGGGCATGG + Intergenic
1050184678 9:2960456-2960478 GCTTGAGCCCCAGGAGGTCAAGG - Intergenic
1050287433 9:4118055-4118077 GCCCGAGCTCCGGGTGGTGAAGG + Exonic
1052797387 9:32935765-32935787 GCATGAGCTCCTGGAAGACATGG + Intergenic
1053137924 9:35663322-35663344 GTGTGAGCTGTTGATGGTCAGGG + Exonic
1056635672 9:88329348-88329370 GCGTGTGCCCAAGGTGGTCAAGG + Intergenic
1056815339 9:89796911-89796933 GCGTGAGGACCTGGTGGCCAGGG - Intergenic
1056826570 9:89880081-89880103 GTGTGGGCTCCTGGTGGCGAGGG + Intergenic
1056994681 9:91445118-91445140 GACTGTGGTCCTGGTGGTCAGGG + Intergenic
1057150584 9:92792781-92792803 GCTGTATCTCCTGGTGGTCAGGG + Intergenic
1057300682 9:93879990-93880012 GCGCGAGTTCCGGGTGGGCATGG + Intergenic
1058235710 9:102487251-102487273 GCGTGAGTTCCGGGTGGGCGTGG - Intergenic
1058923402 9:109639796-109639818 CCGTGAGCTCCTGCAGGGCAGGG + Intergenic
1059099559 9:111456805-111456827 GCGTAAGAGCTTGGTGGTCATGG + Intronic
1060115854 9:120939884-120939906 CTGTGAGCTCCTGGCGGACAGGG - Intergenic
1060303645 9:122391656-122391678 GCATGAGCTCCTTGTGATCCTGG + Intronic
1061546568 9:131308113-131308135 GCGTGTGCTGCTGGTGCTCTGGG + Exonic
1203745656 Un_GL000218v1:39562-39584 AGGTGAGCTCCTGGAGGCCACGG - Intergenic
1203564451 Un_KI270744v1:79921-79943 AGGTGAGCTCCTGGAGGCCACGG + Intergenic
1185682104 X:1897231-1897253 TCTTGAGGTCCTGGGGGTCAGGG + Intergenic
1188166980 X:26873972-26873994 GCGTGAGTTCCAGGTGGGCGTGG - Intergenic
1189467143 X:41286020-41286042 GCGTGAGCTCTGGGTGGGCGTGG - Intergenic
1190013654 X:46807488-46807510 GCATGAACTGCTGGTAGTCAAGG + Intergenic
1190324546 X:49199000-49199022 GGGTCAGTTCCGGGTGGTCAAGG - Exonic
1192251376 X:69416817-69416839 GCGCGAGTTCCGGGTGGGCATGG + Intergenic
1192592169 X:72369414-72369436 GACTGAGATCCTGGTGGACAGGG + Intronic
1195320634 X:103719078-103719100 GCCAGAGCTCTGGGTGGTCATGG + Exonic
1195449251 X:104991744-104991766 GTGTAAGCTCCTGGTAGGCAGGG - Intronic
1197688613 X:129472929-129472951 TTGTGAGCTCCTTGTGGGCAAGG - Intronic
1198640688 X:138752668-138752690 GTGTGAACTCCAGGAGGTCAGGG - Intronic
1199652749 X:149963311-149963333 CCGGGAGCTCCTGGAGGGCAGGG - Intergenic
1199900797 X:152170077-152170099 GTGTGAGCTCCTGGAAGACAGGG - Intronic
1201158985 Y:11154574-11154596 AGGTGAGCTCCTGGAGGCCACGG - Intergenic
1201424221 Y:13831398-13831420 GCGTGAGTTCTGGGTGGGCATGG + Intergenic