ID: 1035257157

View in Genome Browser
Species Human (GRCh38)
Location 7:157637737-157637759
Sequence TTTCAGAAGAAGGATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 736
Summary {0: 1, 1: 0, 2: 6, 3: 53, 4: 676}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035257148_1035257157 23 Left 1035257148 7:157637691-157637713 CCATTTTTACTCCACTGATGACG 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1035257157 7:157637737-157637759 TTTCAGAAGAAGGATGAGGAGGG 0: 1
1: 0
2: 6
3: 53
4: 676
1035257150_1035257157 12 Left 1035257150 7:157637702-157637724 CCACTGATGACGACAGTGGTTCT 0: 1
1: 0
2: 0
3: 15
4: 98
Right 1035257157 7:157637737-157637759 TTTCAGAAGAAGGATGAGGAGGG 0: 1
1: 0
2: 6
3: 53
4: 676

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035257157 Original CRISPR TTTCAGAAGAAGGATGAGGA GGG Intronic
900297873 1:1961179-1961201 TTTCAAAAGGAGGAGCAGGAGGG + Intronic
901110437 1:6789076-6789098 TTGCAGAAGCAGGATAAGTAAGG - Intronic
901246396 1:7735199-7735221 CTTCAGAAGAAGCAAGAGGCTGG + Intronic
901900460 1:12357388-12357410 TTTCAGGAGAAGAATGAGACTGG - Intronic
902095416 1:13940167-13940189 TTCCAAAAGAATGAAGAGGAGGG - Intergenic
904098860 1:28005293-28005315 TTACAAAAAAAGGAAGAGGAGGG + Intronic
904145092 1:28384197-28384219 TTCCAAAAGAATGAAGAGGAGGG - Intronic
905551987 1:38849293-38849315 ATTAAGCAGAAGGATGAGGCAGG - Intronic
907342070 1:53742299-53742321 AATTAGGAGAAGGATGAGGATGG - Intergenic
907537478 1:55178116-55178138 CGTCAGAAGAATGATGAGAATGG - Exonic
908047762 1:60189998-60190020 TTTCAGAAGACAGATGCAGATGG + Intergenic
908413263 1:63887294-63887316 TGTCTGAAGAAAGAAGAGGAGGG + Intronic
908436337 1:64110517-64110539 AAGCAGAAGAAAGATGAGGATGG - Intronic
908916091 1:69128227-69128249 TTTCTGAGAAAGGATGGGGAGGG - Intergenic
908935993 1:69376147-69376169 TTACACAAGTAGGATGAGGTGGG + Intergenic
909914789 1:81303467-81303489 GTTCACCAGAATGATGAGGAGGG - Intergenic
910225951 1:84936269-84936291 TTCCAGAATAATGATGAGGTAGG + Intronic
910709538 1:90165492-90165514 TTTCAGAAGCAGGTTGGGGATGG + Intergenic
910724044 1:90319789-90319811 TTCCAGAAAATGGAAGAGGAAGG - Intergenic
912164867 1:107031063-107031085 TTTAAGAATGAGGATGAGGGAGG - Intergenic
912718721 1:112002067-112002089 TTCCAGGAGAGAGATGAGGAGGG + Intergenic
912826846 1:112912548-112912570 ATTCAGTATAAGGATAAGGAGGG - Exonic
913192543 1:116425987-116426009 CTTCACAAGAAGGATCAGGCAGG - Intergenic
913291840 1:117280744-117280766 TTTCAGAGGGAGGCTGAGGCAGG + Intergenic
913478518 1:119262304-119262326 GTACAGAAGAGGGAAGAGGAGGG - Intergenic
913546752 1:119876505-119876527 CTTCAGAAAACAGATGAGGAAGG + Intergenic
914568640 1:148892660-148892682 TTTGATGAGAAGGAAGAGGAGGG - Intronic
914680464 1:149935226-149935248 GAACAGAGGAAGGATGAGGAGGG + Intronic
915893889 1:159796058-159796080 TTTGAGAAGAGGAATGAGTAGGG + Intergenic
916344566 1:163773330-163773352 TTTCAGAAGTAGGGTGAGCTTGG - Intergenic
916542053 1:165766484-165766506 TTGCAGAAGAATGATCAGTAAGG + Intronic
916651104 1:166835567-166835589 AAGCAGAAGAAGGAGGAGGAAGG - Intergenic
917148686 1:171921565-171921587 TTTAAAAAAAAGGAGGAGGAGGG - Intronic
917196471 1:172471261-172471283 CTTGAGAAGAAGGATAAGAAAGG + Intergenic
917375298 1:174346276-174346298 TTTCAAAAAAAGGAGGAGAAAGG - Intronic
917447778 1:175121247-175121269 TTACAGAAGAAGGGGGAGAATGG + Intronic
917510705 1:175667094-175667116 GTGGTGAAGAAGGATGAGGAAGG - Intronic
917511251 1:175670991-175671013 ATTCAGGTGAAGGATGATGATGG + Intronic
917971037 1:180207909-180207931 TTTCAAAAAAAGGATGAGAAAGG - Intergenic
918046088 1:180941845-180941867 TGTTAAAAGAAGAATGAGGAGGG - Intronic
918323866 1:183391195-183391217 TTGCAGAGTGAGGATGAGGATGG - Intronic
919045049 1:192440858-192440880 TTTAAGTAGAATGATCAGGATGG + Intergenic
919160869 1:193828952-193828974 TCTCAGAAGAAGAATGATCAGGG - Intergenic
919178457 1:194050384-194050406 TTTCAGAAGAAAAAAGAGAAGGG + Intergenic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919784016 1:201246712-201246734 TTGCTGAAGAAGGAAAAGGAGGG + Intergenic
920559439 1:206928817-206928839 TTTTAGAATAAGGAGGAGGAGGG - Exonic
920703944 1:208238240-208238262 TTTCAGAGGGAAGAGGAGGAGGG - Intronic
920825480 1:209420985-209421007 TTTCAGAAGAATGTTCTGGATGG + Intergenic
921650954 1:217677483-217677505 ATTCAGAAAAAGGATACGGAAGG + Intronic
922193362 1:223339249-223339271 TTTCAGAGGAACGATGGGGGTGG + Intronic
922948552 1:229538273-229538295 ATTCAGAGGAGGGAAGAGGAGGG + Intronic
923016439 1:230130197-230130219 TTACAGAAGAAAGATATGGATGG - Intronic
923352710 1:233125314-233125336 TTTAAGAAGCAGGTAGAGGAAGG - Intronic
923462590 1:234219992-234220014 GATCAGAAGAAGCAGGAGGAGGG + Intronic
923548737 1:234944186-234944208 TTTAAGGACAAGGAGGAGGAAGG + Intergenic
924907834 1:248475040-248475062 TTTCAGAAGAAACATGCTGAGGG - Intergenic
924916274 1:248573046-248573068 TTTCAGAAGAAACATGCCGAGGG + Intergenic
1062790543 10:301665-301687 TTTCAGGAGATGGAAGAGGCAGG - Intronic
1063465037 10:6237414-6237436 TTGCAGAAGGAGGCTTAGGAAGG + Intergenic
1063511664 10:6650372-6650394 GTTCAGAAGGATGATGAGAATGG - Intergenic
1064454885 10:15478131-15478153 TTTCAGAAGAAGGAGAAGCTGGG + Intergenic
1064731516 10:18335908-18335930 TTTGAAGAGAAGGATGAGGATGG - Intronic
1065060309 10:21894268-21894290 TTTCAGAAAATAGAAGAGGAAGG + Intronic
1065735177 10:28745057-28745079 TTTCAGTAGGATGATGGGGAAGG + Intergenic
1066123348 10:32313592-32313614 TTTAAGAAGAAGGAACAGGCTGG + Intronic
1066546655 10:36507466-36507488 TTGCAGAGGAAGAATGAGGTTGG - Intergenic
1066608918 10:37214221-37214243 TGACAAAAGAAGGCTGAGGAAGG - Intronic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067397232 10:45933175-45933197 TTTTAAAAGAAGGATGAAAATGG + Intergenic
1067865554 10:49902276-49902298 TTTTAAAAGAAGGATGAAAATGG + Intronic
1068743378 10:60500691-60500713 GTTCAGATTAAGGATGAGGCAGG - Intronic
1069536982 10:69261112-69261134 TTGGAGAAGAAGGATAAGGTTGG - Intronic
1070269754 10:74941782-74941804 TTTCAGAAAATAGAAGAGGAGGG + Intronic
1070317607 10:75330385-75330407 TTCCAGAAAATGGAAGAGGAAGG - Intergenic
1070402937 10:76069237-76069259 TTTCACAAGCATGATGGGGAAGG + Intronic
1070676634 10:78416217-78416239 TTTCTGAAGAAGGAAGATGGAGG - Intergenic
1071718617 10:88120859-88120881 CTTCAGGTGAAGGAGGAGGAAGG - Intergenic
1071973435 10:90931147-90931169 TTTGGGAAGGCGGATGAGGAGGG - Intergenic
1072774997 10:98182384-98182406 TTCCAGAGGAAGGATCAGGCAGG - Intronic
1073190553 10:101647699-101647721 TTTCAGAAGAATGATAAGAAAGG + Intronic
1073428016 10:103467982-103468004 TCTCAGCAGAAGGTTCAGGAAGG - Intergenic
1073558408 10:104476022-104476044 TTTCAGATGGAGGGTGAAGAGGG + Intergenic
1073644061 10:105281489-105281511 TTTCACATGGAGGATGAAGAAGG - Intergenic
1074390217 10:113050825-113050847 TTTCAGAAGTGGGATGGGAAGGG - Intronic
1075193588 10:120334236-120334258 TTCCAGATGGAGGGTGAGGAAGG + Intergenic
1075411676 10:122233179-122233201 TTTGACCAGAAGGATGTGGAAGG - Intronic
1075462344 10:122625363-122625385 TTCCAGAAGTAGGAGGAGTAGGG + Intronic
1076595419 10:131622189-131622211 ATCCTGAAGAAGGATGAGCAAGG + Intergenic
1077262697 11:1631263-1631285 CTTCAGCGGAAGGATGAGGAAGG + Intergenic
1078181973 11:9019287-9019309 TTTCACAAGAAGGCTAGGGATGG - Intergenic
1078313486 11:10270695-10270717 TTTAAGAAGTAAAATGAGGACGG + Intronic
1078448935 11:11426036-11426058 TTTGACAAGGAAGATGAGGAGGG + Intronic
1078470219 11:11580465-11580487 GTTCAGTAGCAGGATGCGGAAGG - Intronic
1079349813 11:19682967-19682989 TTGCAGAACTAGGATGAGGGAGG + Intronic
1079588554 11:22154933-22154955 TTTAGCAAGAAGGATGAGGAAGG - Intergenic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080695417 11:34599630-34599652 TTTCAGAAGAATTATGACTATGG - Intergenic
1080910176 11:36588925-36588947 TGTCAGGAGAGGGGTGAGGAAGG - Intronic
1081404731 11:42683837-42683859 AATCAGAAGAAAGATGAAGATGG + Intergenic
1082179096 11:49097301-49097323 TTTCAGAAGAAAGAAAGGGAAGG - Intergenic
1082673697 11:56069090-56069112 TTACAGAAGGAGGATGATGAAGG + Intergenic
1084527773 11:69707443-69707465 TTTCAGAATAACGATGCGTATGG - Intergenic
1084693824 11:70742228-70742250 TGCCAGCAGAAGGAGGAGGAAGG - Intronic
1085131011 11:74038600-74038622 TATCAGCAGAAGTATGAGGAAGG - Intronic
1085481089 11:76823607-76823629 TTTCAGGAGAAGGAGGTGGGAGG + Intergenic
1085919794 11:80939061-80939083 GTCCAGAAGATGGATGATGATGG + Intergenic
1086195003 11:84127360-84127382 TAGCAGAAGAAGGATTAGAAAGG - Intronic
1086614400 11:88798259-88798281 TTTCAGACAAATGAAGAGGATGG - Intronic
1086700347 11:89894714-89894736 TTTCAGAAGAAAAAAGGGGAGGG - Intergenic
1086705823 11:89949812-89949834 TTTCAGAAGAAAAAAGGGGAGGG + Intergenic
1086979438 11:93177711-93177733 TTCCAGAGGAAGGATCAGGCAGG - Intronic
1087079317 11:94154595-94154617 TTTACGAAGAAGGATGCTGATGG - Intronic
1087209599 11:95433309-95433331 TTTCAGAGGAAGGAAGTGAAGGG - Intergenic
1087394631 11:97581872-97581894 TATCAGAAGAAGAAAGAGAATGG + Intergenic
1087632269 11:100664221-100664243 TCTCTGAAGAAGGATGGTGACGG + Intergenic
1087661898 11:100998157-100998179 CTCCAGAAGAAAGATGAAGATGG + Intergenic
1087664703 11:101030877-101030899 ATTCAGAAGAAGGAAGATGTAGG + Exonic
1087840837 11:102919464-102919486 TTTCAGAGGAAAGGTGAGTAAGG + Intergenic
1088337020 11:108717154-108717176 TTTCAGCAGATAGATGAGGTGGG + Intronic
1088446939 11:109941020-109941042 TTTGAAAACAAGGAGGAGGAAGG + Intergenic
1088591716 11:111409055-111409077 TTTCAGAAGGAGGAAGAGATGGG + Intronic
1089007929 11:115108131-115108153 TTTCAGAAGAAAGCTGAAGGAGG - Intergenic
1089377329 11:118003860-118003882 TTCCACATGAAGGATGAGGCAGG + Intergenic
1090079759 11:123604086-123604108 TTTCAGGGGAAAGATCAGGAGGG + Intronic
1090204822 11:124878374-124878396 GTTCACAAGAAGGAGGAGGTGGG - Exonic
1090651222 11:128807870-128807892 TTTCGGAGGAAGCAGGAGGAAGG - Intronic
1091066230 11:132515676-132515698 ATTCAGAAGAAGGAGGAAAAGGG - Intronic
1092043775 12:5409884-5409906 CTTCAGCTGAAGGATTAGGAGGG - Intergenic
1092057551 12:5520533-5520555 TTTCAGTGGAAGGGTGGGGAGGG + Intronic
1092337655 12:7647911-7647933 TTTTAGTAGGAGGATGAGAAGGG - Intergenic
1093364823 12:18280928-18280950 TAGAAGAAGAAAGATGAGGAAGG + Intronic
1093677039 12:21954853-21954875 TTTCAGAAAATGGATGAGGAGGG - Intergenic
1093702372 12:22236503-22236525 TTTAAAAAGAGGGCTGAGGAGGG + Intronic
1094098063 12:26730328-26730350 GTTTAGAAGCAGGATGAGGAGGG - Intronic
1094220324 12:27985960-27985982 ATTCAGAGGAAGGATGAGCCTGG + Intergenic
1094221219 12:27995664-27995686 TTAAACAAGAAGGAAGAGGAGGG - Intergenic
1094272018 12:28627338-28627360 GTTGAGAAGAAGAATGAGTAGGG + Intergenic
1094317884 12:29151947-29151969 TTTCAGAAGTAGCTTGAGGAAGG + Intronic
1094377400 12:29804517-29804539 TTTCAGAAAATAGAAGAGGAAGG - Intergenic
1094451143 12:30584233-30584255 GTTCAGATGAGGGATGATGAAGG + Intergenic
1095398853 12:41791688-41791710 TTTAAAAAGTAGGATTAGGATGG - Intergenic
1095472152 12:42548822-42548844 TTTAAGAAGAAGGGTGAGGCCGG + Intronic
1095499239 12:42818385-42818407 TACCAGATGATGGATGAGGAAGG - Intergenic
1095541481 12:43313339-43313361 TTGAAGAAAAAGGAAGAGGAGGG - Intergenic
1095625904 12:44314793-44314815 TTTCAAAAAATGGAGGAGGATGG - Intronic
1096069427 12:48766706-48766728 TGTCAGAAGGGGCATGAGGAGGG + Exonic
1096233704 12:49911830-49911852 CTTCTGAACAATGATGAGGATGG - Intergenic
1096464254 12:51839482-51839504 ACACAGAAGAAGGATTAGGAAGG - Intergenic
1097994446 12:65872223-65872245 TTTCAGAAGAGACATCAGGACGG - Intronic
1098175417 12:67785286-67785308 TTACAGAAGTAGGATGAGAATGG + Intergenic
1098187648 12:67914892-67914914 TTACAGCAGAAGGATGAGGAAGG + Intergenic
1098535490 12:71589833-71589855 ATTCAGAAGATTGCTGAGGAAGG + Intergenic
1099321547 12:81156959-81156981 TTTCAGAAAATAGAAGAGGAGGG + Intronic
1099810141 12:87569988-87570010 TTTCACAGGAAGGACGAGGGGGG - Intergenic
1101184253 12:102257065-102257087 TTTCAGAACATAGAAGAGGAGGG - Intergenic
1101230489 12:102736404-102736426 GTTCAGAAGAAGTATGAAGAGGG - Intergenic
1101267310 12:103102543-103102565 ATTCTGAAGAGCGATGAGGAAGG - Intergenic
1101269408 12:103128001-103128023 ATTCAGAAAAAGGAGGAGAAAGG - Intergenic
1101400305 12:104381402-104381424 TTTCAGAAAATAGAAGAGGAGGG - Intergenic
1101627610 12:106461019-106461041 TTTCAGGAGAATGAGGAGGTAGG - Intronic
1101795498 12:107969354-107969376 TTTGAGAAGAAGGATTTGCATGG - Intergenic
1102065382 12:109970717-109970739 TTGCAGAAGAATAATGTGGAAGG - Intronic
1102167991 12:110821209-110821231 TTTGAGAAGAAAGAAGAGGCTGG - Intergenic
1102320188 12:111926578-111926600 TCACAGAAGAAGGATCAAGAGGG - Intergenic
1102474617 12:113180638-113180660 TTTCAGAAGGAGGGAAAGGATGG - Intronic
1103102096 12:118186625-118186647 TTACAGAAGAAGGAAAAGAAAGG + Intronic
1103242881 12:119429607-119429629 TTTCAGAAGATGGAGGTGAAGGG - Intronic
1103680629 12:122690774-122690796 TTTCATTAGAAGGATCATGAAGG - Intergenic
1104091010 12:125517722-125517744 TTTCAGTAGAATTATGGGGATGG - Intronic
1104378215 12:128283931-128283953 GTTCAGAAGCAGGAGGAAGAGGG + Intronic
1104398242 12:128453787-128453809 TTTCAGAATAAGAAGAAGGAAGG + Intronic
1104434203 12:128742892-128742914 TTGCAGAAGAAAGATGCGGGAGG + Intergenic
1104539784 12:129653185-129653207 TTTGATAACCAGGATGAGGAGGG + Intronic
1104732657 12:131116570-131116592 CTCCAGAGGAAGGAGGAGGAGGG - Intronic
1105773117 13:23631731-23631753 TTAAAGGAGAAGGAAGAGGAGGG + Intronic
1105864080 13:24443388-24443410 TATCAGAAGAAGCCAGAGGAGGG - Intronic
1105979958 13:25508911-25508933 TAACAGAAGAAGGATGAGAAGGG - Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106793414 13:33179834-33179856 ATTCAGAAGAAGGCAGAAGAAGG + Intronic
1107470757 13:40689000-40689022 TTTCAGAACAAGGAAGCAGACGG + Intergenic
1107829572 13:44362422-44362444 GTTCAGGAGGAGGAAGAGGAAGG - Intergenic
1108087297 13:46806824-46806846 TTTTAGAAGATGGAGTAGGAGGG + Intergenic
1108196796 13:48002948-48002970 TTCCAGAAGATAGAAGAGGAAGG + Intergenic
1108437938 13:50419702-50419724 TTACAGCAGGAGGAGGAGGAGGG + Intronic
1109140188 13:58704853-58704875 TTTCAGGTGCAGGATGTGGAAGG + Intergenic
1109805541 13:67436331-67436353 TTTCTGAAGATGGAAGAGAAAGG + Intergenic
1109910958 13:68909305-68909327 TTTCAAAAAATGGAGGAGGAGGG - Intergenic
1109988476 13:70021189-70021211 TTTCAGAAGATGGGGGAGGCAGG - Intronic
1110177120 13:72570122-72570144 TTTAAGAAGCAGGGTGAGGTTGG - Intergenic
1110187613 13:72693303-72693325 TTTCAGAAGATGTATGAAAAAGG + Intergenic
1110371050 13:74740684-74740706 TATATGAGGAAGGATGAGGAGGG - Intergenic
1110782190 13:79479731-79479753 TTTAAAAAGAACTATGAGGAAGG + Intergenic
1110920915 13:81084203-81084225 TCACAGAAGATGGATGTGGAGGG - Intergenic
1111147710 13:84206082-84206104 TTTGAGAAGAAGAATGGGAAAGG + Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1112658410 13:101477941-101477963 TTTCAAAAAATGGAGGAGGAGGG + Intronic
1114082195 14:19210945-19210967 TTTCAGAGGATGTATGAGAAAGG + Intergenic
1114563861 14:23613748-23613770 TTCCAGAAAATGGAAGAGGAGGG + Intergenic
1114814643 14:25943014-25943036 TGCCAGAAGAAGGATGAGCTGGG + Intergenic
1114964429 14:27939723-27939745 TTCCAGAGGAAGGATCAGGCAGG + Intergenic
1115023219 14:28708418-28708440 TTGCAGAAGAAGCATGTGGATGG + Intergenic
1115448194 14:33516414-33516436 TTTCATCAGGAAGATGAGGAGGG - Intronic
1115649114 14:35390532-35390554 TTACAGAGGCAGGATGGGGAGGG + Intergenic
1116129746 14:40839740-40839762 GCTGAGAAGAAGGAGGAGGAGGG - Intergenic
1116506575 14:45689940-45689962 TTCCAAAAGATGGAAGAGGAAGG + Intergenic
1116787478 14:49303544-49303566 TTCCACAAGAAGGAAGGGGAGGG + Intergenic
1117613433 14:57507552-57507574 TTGCAGAAGCAGGAAGATGATGG - Intergenic
1117654439 14:57940010-57940032 TTTCAGTAGAATGATGGGGATGG + Intronic
1118072981 14:62266082-62266104 TTTAAGTAGAAGGTTGAAGAGGG + Intergenic
1118146974 14:63148402-63148424 TTTCAAAAAATGGAAGAGGAGGG - Intergenic
1118412189 14:65492704-65492726 TTTCAGGAGAAGGAAGAGAAAGG + Intronic
1119186587 14:72647118-72647140 TAATAGAAGAAGGATGAGGTGGG - Intronic
1119226089 14:72945651-72945673 TTCAAGAGGAAGGATGAGAATGG - Intronic
1119650578 14:76380181-76380203 ATTCAGCAGAGGGCTGAGGAAGG - Intronic
1120300437 14:82699580-82699602 TTACAGGAGAAGGATGTAGAAGG + Intergenic
1120427975 14:84374992-84375014 TTTCAGAAGAATGATGGGCCTGG + Intergenic
1120513038 14:85438485-85438507 TCTGAGAAGAAGGAGGAGGGCGG + Intergenic
1120824286 14:88941380-88941402 TTTGAGAAGCATGATGAAGAAGG - Intergenic
1122146333 14:99691106-99691128 TTTTGGAAAAAGGATGAGGTTGG + Exonic
1122852086 14:104540123-104540145 TTTCAGAAAACTGAAGAGGAGGG - Intronic
1124205746 15:27718638-27718660 TTCCAGGAGAGGGAGGAGGATGG - Intergenic
1125247971 15:37663610-37663632 TTTCAAAAAAATGAGGAGGAGGG - Intergenic
1125409499 15:39390706-39390728 TTTCAGTAGAAGGATGAGGCAGG - Intergenic
1126307270 15:47274251-47274273 TTTCAGTAGGGGGGTGAGGATGG - Intronic
1126890858 15:53202816-53202838 TCTCAGTAGAATGATGAGGAAGG - Intergenic
1127517014 15:59705956-59705978 TATCAGAAGAAGGATGACCGTGG + Intergenic
1127574595 15:60278747-60278769 TATGAGAAGAAAGATGAGCAGGG - Intergenic
1127706332 15:61550579-61550601 TTTAAGAAAAAGAATGAGGGAGG - Intergenic
1128890929 15:71331226-71331248 TGCCAGAAGAAGTACGAGGAAGG - Intronic
1129309071 15:74692465-74692487 TTTCAGAAAACAGAGGAGGAAGG + Intronic
1129363475 15:75039691-75039713 TTTCAGAAGATGGAAGCGAAAGG - Intronic
1129978292 15:79842285-79842307 TTCCTGAAGAAGAATTAGGAAGG + Intronic
1130071818 15:80653421-80653443 TTTCAGAGGATGGAGGAGGTAGG - Intergenic
1130395665 15:83498933-83498955 TTTCAGCAGAAGGAAGAACATGG - Intronic
1130558854 15:84943416-84943438 ATACAGAAGATGCATGAGGAGGG - Intronic
1130559388 15:84946608-84946630 ATACAGAAGATGCATGAGGAGGG - Intergenic
1130806089 15:87324668-87324690 ATTCAGGAGAACGAAGAGGAAGG + Intergenic
1131059062 15:89393238-89393260 TTTGAGAAGAAGGGACAGGAAGG - Intergenic
1131460726 15:92615877-92615899 TTTCTGAAGAGGGGAGAGGAGGG - Intergenic
1131589854 15:93736971-93736993 TTCCAGAAGATTGAGGAGGAGGG - Intergenic
1132364381 15:101246204-101246226 TGTCAGAAGAAAGAGGTGGATGG - Intronic
1133078586 16:3299699-3299721 ATTCAGAGGAAGGATGAGCCGGG + Exonic
1133583220 16:7166501-7166523 TTGGAGAAGAAGGAACAGGATGG + Intronic
1134125303 16:11612326-11612348 TTTCACAAGAATGATGAGGACGG - Intronic
1134640956 16:15828885-15828907 TTTAAAAAGAAGGAAGAGGCCGG + Intronic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1137226548 16:46517084-46517106 TTTCAGAAGAAGCAAAAGCATGG - Intergenic
1137486471 16:48895479-48895501 TTTCAGCAGAAGGAAGAATAAGG - Intergenic
1137593027 16:49705424-49705446 TTGCAGAACAAGAATGTGGATGG + Intronic
1137936532 16:52640232-52640254 TGTGAGAAGAAGGAAGAGGGAGG + Intergenic
1137961081 16:52882946-52882968 CATCAGAAGAAGGAGGAGAATGG - Intergenic
1140799810 16:78476017-78476039 TTACAGAGGAAGCATGAGTAAGG - Intronic
1141138993 16:81484926-81484948 TTTCAGGGGTAGGAGGAGGAAGG - Intronic
1141143689 16:81514339-81514361 TTCCAGAAGTGGCATGAGGAGGG + Intronic
1142191714 16:88721196-88721218 TTTTAGAAGAAGGAAGAAGGAGG - Exonic
1143709445 17:8724227-8724249 CTTCTGAAGAAAGAAGAGGAGGG - Intergenic
1143729078 17:8870166-8870188 TGGCAGAAGGAGGAGGAGGAAGG - Intergenic
1143853494 17:9831274-9831296 TGTGAGACGGAGGATGAGGAAGG - Intronic
1144041397 17:11414140-11414162 GTACAGAAGAAAGATGAGGAAGG - Intronic
1144417189 17:15060687-15060709 TTTCAGAAAATAGAGGAGGAGGG + Intergenic
1144810755 17:17997407-17997429 TTTCAGGAGCAGGCTGCGGAGGG - Intronic
1145779192 17:27550825-27550847 CTTGAGAAGGAGGATGGGGAGGG + Intronic
1145843185 17:28013677-28013699 TATCACAAGAAGGATGAGTCAGG + Intergenic
1146682795 17:34820668-34820690 TTTCAGGAGCAGGAGGAAGATGG - Intergenic
1146761049 17:35479106-35479128 ATTCAGAACCAGGTTGAGGAAGG - Exonic
1147304166 17:39551869-39551891 TTTCTGAGGAAGGAGGAGGATGG - Intronic
1147613662 17:41815805-41815827 TTTCAGAAGTAAAGTGAGGATGG - Intronic
1147996256 17:44362025-44362047 TTTCAGAAGAGGGAGGGGGCTGG + Intronic
1148245602 17:46027942-46027964 TTGGAGAACAAAGATGAGGAGGG - Exonic
1148653654 17:49267584-49267606 TGCAAGAGGAAGGATGAGGAAGG + Intergenic
1150968743 17:70002644-70002666 TGTCAAAAAAATGATGAGGAAGG + Intergenic
1151166113 17:72205306-72205328 TTTCTGTGGATGGATGAGGAGGG - Intergenic
1151209553 17:72534129-72534151 TTGCAGGAGATGGATGTGGAAGG - Intergenic
1151223769 17:72633327-72633349 TTTAATAACAAGGAGGAGGAGGG + Intergenic
1152047384 17:77946382-77946404 TTTCAAGAGCAGGATTAGGAGGG - Intergenic
1152984042 18:306078-306100 CTGCAGATGAAGGATGAGAAGGG + Intergenic
1154464294 18:14629282-14629304 TTCCAGAAGAAGAAGGAGGGAGG - Intergenic
1154981826 18:21508696-21508718 TTTCCGAAGAGTGGTGAGGAGGG - Intronic
1155001780 18:21694765-21694787 TCTCAGTAGAGCGATGAGGAAGG - Intronic
1155332183 18:24729653-24729675 TTTGAGATGAAAGATGAAGAAGG - Intergenic
1155525716 18:26714530-26714552 TTGCAGAAGAAGGAAGACTAGGG + Intergenic
1155535723 18:26815221-26815243 TTTCAAAAGATTGAAGAGGACGG - Intergenic
1155740447 18:29282353-29282375 GTTCAGAAGAAGCATGTGGATGG - Intergenic
1156770829 18:40722033-40722055 TTTCAAAAAATTGATGAGGAGGG + Intergenic
1157379645 18:47201988-47202010 TTTAGGAAGAGGGATGAGAAGGG - Intergenic
1157518235 18:48326390-48326412 TTTTAGAAGAAGGTAGAGGCCGG - Intronic
1158549393 18:58422319-58422341 TTCTGGAAGAAGAATGAGGAAGG - Intergenic
1159509547 18:69378691-69378713 TTTCAGCAAAATGATGAGGTAGG - Intergenic
1159638271 18:70832685-70832707 TTCCAGAATAATGAAGAGGAGGG - Intergenic
1159704170 18:71666066-71666088 TGCCAGCAGAAGGATGAGGAGGG + Intergenic
1159726636 18:71968200-71968222 TTACAGAAGGAGGATCATGAAGG - Intergenic
1160958966 19:1708951-1708973 TACCAGATGAATGATGAGGAAGG + Intergenic
1161223285 19:3129093-3129115 TTTCAGAAAATAGAAGAGGATGG + Intergenic
1163105142 19:15119082-15119104 CTTCACACGAAGGAGGAGGAAGG - Intronic
1163361856 19:16851741-16851763 TTTGAAAAGGAGGAGGAGGAAGG + Intronic
1164248550 19:23457078-23457100 TTCCAGAGGAAGGATCAGGCAGG - Intergenic
1164634263 19:29781125-29781147 TTCTGGAAGAAGGATGAAGAGGG - Intergenic
1165122690 19:33571196-33571218 TTACAGAAGAAGGAAGAGAAAGG + Intergenic
1165242258 19:34478203-34478225 GTCCAGGAGAAGGATGGGGATGG - Intergenic
1165471549 19:36007328-36007350 TTACAGAAGAGGGGTGGGGATGG - Intronic
1165551287 19:36588542-36588564 TTTCAGAACAAGGATGACAGAGG - Intronic
1165647099 19:37450183-37450205 TTTCAGAATATTGAGGAGGAGGG - Intronic
1165758694 19:38308504-38308526 TGACAGAGGGAGGATGAGGATGG + Intronic
1166743915 19:45130884-45130906 TCTCAGAGGAGGGATGGGGAGGG - Intronic
1167736007 19:51294909-51294931 TCTCTGAAGAAGGCTGAGGCTGG - Intergenic
925097624 2:1219894-1219916 TTTCAGAAGAAGAAGGCAGATGG + Intronic
925840651 2:7988991-7989013 TTTCTGGAGAAGGAGTAGGAAGG + Intergenic
926207516 2:10844664-10844686 TTTGGGGATAAGGATGAGGAAGG - Intergenic
926410565 2:12597897-12597919 TTCCAGAAGAAAGAAGAGGCAGG - Intergenic
926464748 2:13174606-13174628 TTTCAGAAAATAGAAGAGGAGGG - Intergenic
927158923 2:20240482-20240504 TTTAAGAAGAAGGACAAGGGAGG - Intergenic
927544272 2:23939534-23939556 TTTCAGGCGGTGGATGAGGAGGG + Intronic
927585731 2:24302509-24302531 TTTTAAAAGAAGGATAATGATGG + Intronic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
928484349 2:31714404-31714426 TTTCACAAAAAGGAAGAGGAAGG + Intergenic
928660108 2:33493265-33493287 TTTCTCAAGAAGGATAGGGATGG - Intronic
928663165 2:33524518-33524540 CTTCTGAAGAAAGATGAGAATGG - Exonic
928821437 2:35366497-35366519 TTTCAGAAGAAGTATGGAAATGG + Intergenic
929368121 2:41186526-41186548 TTTTAACAGAATGATGAGGATGG - Intergenic
929605781 2:43233179-43233201 TGTCACCAGAAGGATCAGGAAGG + Intronic
929842041 2:45477176-45477198 TTTTAGAGGGATGATGAGGAGGG - Intronic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930704486 2:54490734-54490756 TTAGTGAAGAAGGATGAGGCTGG + Intronic
930945703 2:57072322-57072344 ATTGAGGAGAAGGAAGAGGAGGG - Intergenic
931049695 2:58397426-58397448 TTTCAGAAGAAGGGTAAGTTAGG - Intergenic
931152633 2:59591998-59592020 TTTCAAAGGATGGAAGAGGAGGG + Intergenic
931168758 2:59779740-59779762 TTTCATCAGAATGAGGAGGAGGG + Intergenic
931516878 2:63055296-63055318 TTTGAGCAGAAGGATGGGGGAGG + Intronic
931924633 2:67057898-67057920 TTTGTGCAGAAGGAAGAGGAGGG - Intergenic
932018037 2:68053109-68053131 TTTTAGAAGGAGTATGTGGAAGG - Intronic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
932689759 2:73902264-73902286 TCTCTGAAGAAGGATAAGGATGG - Intronic
933101393 2:78262720-78262742 TTACAGAAGTACAATGAGGAGGG + Intergenic
933766231 2:85711446-85711468 TTCCAGAAGGAGGATGACGGGGG + Intergenic
933832077 2:86219114-86219136 TTTCAGTTGTAGGATGTGGATGG - Intronic
935440264 2:103085619-103085641 TTTCAGAACATGGATGCAGAGGG + Intergenic
936388368 2:112050880-112050902 TCTAAGAAGGAGGAGGAGGAAGG - Intergenic
937256749 2:120561141-120561163 TTTCTGAGGAGGGATGAGGCGGG + Intergenic
937492172 2:122381474-122381496 TTTGAGAAGAAAGATTAGAATGG + Intergenic
937715833 2:125031169-125031191 TTTCAGAAAAAGGATGAGCAAGG - Intergenic
938494387 2:131785654-131785676 TTTCAGAGGATGTATGAGAAAGG - Intergenic
938581506 2:132650697-132650719 TTTTAAAGGAAGGAGGAGGAAGG - Intronic
938681746 2:133699323-133699345 TTCCAGAAGAGGGATCAGGAAGG + Intergenic
939063356 2:137451137-137451159 TGTCAGAAGAAGGATTAAGAGGG + Intronic
939113658 2:138036635-138036657 TTCAAGAAGAAAGATGAGTACGG - Intergenic
939376860 2:141379958-141379980 CTTCAGGAGCAGGCTGAGGAAGG - Intronic
939601646 2:144199337-144199359 GTTCAGTAGAAGGCTGAGCACGG - Intronic
939730900 2:145783160-145783182 TTCCAGAGGAAGGATCAGGCAGG + Intergenic
940182534 2:150951817-150951839 TTTAAAAAGAAGGCTGAGCATGG + Intergenic
940447225 2:153790039-153790061 TTTCAAAAAATTGATGAGGAGGG + Intergenic
940463890 2:154003816-154003838 TCACAGAAGGAGGAAGAGGAGGG - Intronic
940466061 2:154028461-154028483 TTTAAGTAGAAAGAAGAGGATGG - Intronic
940591162 2:155729549-155729571 ATTCAGAGGAAGGCTGAGGCTGG - Intergenic
940805002 2:158177211-158177233 TTTCAGTAGAAGGAGGACAATGG - Intronic
941213917 2:162681327-162681349 TTTAGGAAGAAGGATGAGAGTGG + Intronic
941633271 2:167907776-167907798 TTGCAATAGAAGGTTGAGGAGGG - Intergenic
941701977 2:168613354-168613376 TGTGAAAAGAAGGCTGAGGATGG + Intronic
942010781 2:171760858-171760880 TTCCAGAAGAAGGAACAGGCAGG - Intergenic
942616144 2:177793807-177793829 AGTCAGTAGAAGGATGGGGAGGG + Intronic
943181786 2:184553501-184553523 TGACAGGAGAAGGATGAAGAAGG - Intergenic
944900999 2:204216039-204216061 TTGGAGGAGAAGGAAGAGGAAGG - Intergenic
945016565 2:205524753-205524775 TTTCATTAGAAGGGTGAGGCTGG - Intronic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
946164425 2:217855303-217855325 TTTCACGGGCAGGATGAGGAAGG - Intronic
947628021 2:231633291-231633313 TTTCAGAAGGTGGATAAAGAGGG - Intergenic
947772983 2:232685652-232685674 TTTAAAAAGAAGGAAGAGAATGG + Intergenic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948495240 2:238344645-238344667 TTTGAGAAGAAGGTTCTGGAGGG - Intronic
948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG + Intergenic
1168756727 20:323939-323961 TTTCAGGATAAGGAAAAGGAGGG + Intergenic
1168843065 20:922100-922122 TTTCAGAAGAAGGTATAGGATGG + Intergenic
1170236720 20:14114591-14114613 TTTTATAAGAAGATTGAGGAAGG + Intronic
1170487311 20:16831667-16831689 TTTCAGAAAAACTATGAAGAAGG + Intergenic
1170598853 20:17825431-17825453 AGTCTGAAGAAGGATGAGGGTGG + Intergenic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1172516239 20:35536000-35536022 TTCCATAAAAAGGAAGAGGAGGG - Intergenic
1172754434 20:37273301-37273323 CTGCAGTAGATGGATGAGGAAGG + Intergenic
1173075596 20:39816182-39816204 TTTAAGTAGAAGTATGAGGTAGG + Intergenic
1174251521 20:49223346-49223368 CTTCAAGAGAATGATGAGGAAGG + Exonic
1174527091 20:51181463-51181485 TTGCAGGGGAAGGATGTGGAGGG - Intergenic
1175062780 20:56258880-56258902 TTGCAGAAGAAGGCAAAGGATGG + Intergenic
1175071456 20:56337243-56337265 TTCCAGAGGAAGGATCAGGCAGG + Intergenic
1175709113 20:61205172-61205194 TTTCATCAGGAGGATGAGGGGGG + Intergenic
1175879575 20:62249467-62249489 TTTAAGAAAAAGCATTAGGAAGG - Intronic
1176221064 20:63969630-63969652 TTTCTGGAGAAGGAGGAGGCAGG + Intronic
1176613544 21:9008723-9008745 TTTCAGAGGATGTATGAGAAAGG + Intergenic
1176711647 21:10155160-10155182 TTTCAGAGGATGTATGAGAAAGG - Intergenic
1177165074 21:17591983-17592005 TTTCAGGACAAGGTGGAGGATGG + Intronic
1177237429 21:18410553-18410575 TTTCAGCAAAATGATGGGGAGGG + Intronic
1177652203 21:23971920-23971942 TTTCAAAAAATAGATGAGGAAGG - Intergenic
1178046534 21:28700749-28700771 TTTCAGAAAATTGAGGAGGAGGG + Intergenic
1178761174 21:35404275-35404297 TTCCAGAAAAATTATGAGGAAGG - Intronic
1178762874 21:35421008-35421030 TTTCTGCAGAAGGATGAGGCAGG - Intronic
1179068848 21:38053048-38053070 TTTCAGAGGAAGGAAGGGGATGG + Intronic
1180116539 21:45709615-45709637 TTACAGAATTATGATGAGGATGG + Intronic
1180211827 21:46299501-46299523 TGGGAGCAGAAGGATGAGGACGG - Intergenic
1180498580 22:15911725-15911747 TTTCAGAGGATGTATGAGAAAGG - Intergenic
1180769559 22:18371322-18371344 TTGCGGAAGAAGGATGACCAAGG + Intergenic
1180809498 22:18748721-18748743 TTGCGGAAGAAGGATGACCAAGG - Intergenic
1181122262 22:20679041-20679063 TTTGAAAAGAAGGAAAAGGACGG - Intergenic
1181380225 22:22496435-22496457 TTTCAAAAGTAAGCTGAGGATGG - Intronic
1181425409 22:22834450-22834472 GTTCAGAAGAAGGACCAGGTGGG - Intronic
1181456284 22:23061876-23061898 TTTCAGCAGATGGACCAGGATGG + Exonic
1181849096 22:25737020-25737042 TGTCAGAAGAAGCAACAGGAAGG - Intergenic
1182184166 22:28384748-28384770 TTGCAGAAGACGGATGATAAGGG - Intronic
1182199090 22:28551544-28551566 TTTCATACCAGGGATGAGGATGG + Intronic
1182274237 22:29175463-29175485 TATCAGAAGAAGAAAGAGAAAGG - Intergenic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1182595926 22:31420384-31420406 TTTAAGAAGAAGGACAAGGGAGG + Exonic
1182864207 22:33588392-33588414 CTCTAGAAGAAAGATGAGGAAGG + Intronic
1183328161 22:37205484-37205506 TGTGAGGAGAAGGAAGAGGAAGG - Exonic
1183578909 22:38711196-38711218 TCTCTGAGGTAGGATGAGGAAGG - Intronic
1184808413 22:46811759-46811781 TTTCAGAAGAAGGCAGTGGTAGG + Intronic
1184905249 22:47479312-47479334 TTTCAGAAAATGCAAGAGGAAGG - Intronic
1203277594 22_KI270734v1_random:100264-100286 TTGCGGAAGAAGGATGACCAAGG + Intergenic
949106351 3:204413-204435 TATCAGAACAAGGACGATGAAGG + Intronic
949784764 3:7728630-7728652 TTTCAGGAGAAGCCTGAGCAAGG + Intronic
950132061 3:10554039-10554061 TTTCAGAACAAGGCATAGGAAGG + Intronic
950194408 3:10999004-10999026 TTTCAGAAGCAGCATGAGGTTGG - Intronic
950212689 3:11135699-11135721 TTTCATAGGAAGGGTAAGGAGGG + Intergenic
951012228 3:17693877-17693899 TTCCAGAGGAAGGATCAGGCAGG + Intronic
951213037 3:19996538-19996560 TTTCAGAAAATTGAAGAGGAAGG + Intronic
951621833 3:24610258-24610280 TGTGTGAAGAAGGAGGAGGATGG + Intergenic
952047335 3:29338731-29338753 TTATGGAATAAGGATGAGGAAGG - Intronic
952132324 3:30379414-30379436 TTTCAAAAAATAGATGAGGACGG - Intergenic
952291942 3:32025538-32025560 TTTCAGAAAATAGAGGAGGAAGG - Intronic
952775816 3:37045182-37045204 TTTCAGAAAATGGAAAAGGAGGG - Intronic
954130579 3:48558715-48558737 CTGCAAAAGGAGGATGAGGAAGG - Intronic
954494302 3:50939337-50939359 TTCTAGAAAATGGATGAGGAGGG + Intronic
954686452 3:52372735-52372757 ACTCAGAACAAGGATGAGGGTGG + Intronic
955584926 3:60466908-60466930 TTTCATAAAACTGATGAGGAAGG - Intronic
956391833 3:68781718-68781740 TTCCAGAAAAAGGAATAGGAGGG + Intronic
956443865 3:69307046-69307068 TTTCAGAAGAAGTATGAGCGGGG - Intronic
956543949 3:70378442-70378464 TATAGGAAGAAGGATGAGGAAGG + Intergenic
956564413 3:70619452-70619474 ATTCAAAAAAAGGATGAGAAAGG + Intergenic
956887565 3:73575626-73575648 GTTCAGAAGAAGAAAGAGAAGGG + Intronic
957974722 3:87428819-87428841 TTTCACAAGAAGCAGAAGGATGG - Intergenic
958073535 3:88646544-88646566 TTTCAGAAGATGAAAGAGGTAGG - Intergenic
958130086 3:89407599-89407621 TGTCAGAAGAGAGAAGAGGAGGG - Intronic
959172306 3:102858162-102858184 TGTCAGAAGAAGAAGGAAGAAGG - Intergenic
959248842 3:103912825-103912847 TTTCATAAGAAAAAAGAGGATGG + Intergenic
959577719 3:107952286-107952308 ATTTAGAAGAAGAATAAGGAGGG + Intergenic
960168491 3:114431143-114431165 GTACAGAAGAAGAAGGAGGAAGG + Intronic
962047572 3:131776830-131776852 TGGCAGAGGGAGGATGAGGAAGG - Intronic
962107944 3:132413046-132413068 TTTTCAAAGATGGATGAGGAGGG - Intergenic
962234554 3:133696039-133696061 CTTCACAAGAAGGGTGAGTATGG + Intergenic
962386314 3:134935326-134935348 TGTCAGAAGAAAGATGAGCCTGG + Intronic
963371808 3:144410926-144410948 TTTAATAAGAACGATGAGAAGGG + Intergenic
963616479 3:147544939-147544961 TTTCATAAGAAGAATGCAGATGG + Intergenic
964926581 3:161965087-161965109 GTTCAGAAGAAGGGTGAGTCTGG + Intergenic
964986566 3:162748025-162748047 TTTCAGAAAATAGAGGAGGAGGG - Intergenic
965516364 3:169625611-169625633 TTTCAGATGAAAGATGATAATGG - Intronic
965882414 3:173401486-173401508 AATAAGAAGAAGGAAGAGGAGGG + Intronic
966066375 3:175826798-175826820 TTGGAGCAGAAGGATGAGAAAGG - Intergenic
966329590 3:178795555-178795577 TACCAGAAGAAGCCTGAGGAGGG - Intronic
967334328 3:188325495-188325517 TGACAGAAGAATGATGGGGAGGG - Intronic
969915902 4:10491496-10491518 TTTCACAAGAAGCTTAAGGAGGG - Intronic
970110722 4:12635182-12635204 TTTCAGAAGAAGAAACATGAGGG - Intergenic
970344752 4:15142841-15142863 ATTCAGAAGAAAGATAACGATGG + Intergenic
970779883 4:19724101-19724123 TTTCAGAAATACGATGGGGATGG + Intergenic
970866428 4:20764059-20764081 TCTCAGAAGATGGATGAGTGAGG - Intronic
970992888 4:22234094-22234116 TTTCTGAAGGAGGATCAGGGTGG - Intergenic
972019275 4:34288981-34289003 TTTCATTAGAAGAAAGAGGAAGG + Intergenic
972760194 4:42095831-42095853 TCTTAGAAGAAGGAAGATGATGG + Intergenic
972946426 4:44262214-44262236 TTTCAGTAGAGGGATGGGGAAGG + Intronic
973009723 4:45057733-45057755 TTTCAGGAGAAGCCTGAGCAAGG - Intergenic
973269282 4:48244782-48244804 TTTGAGAAGAAGGATGTTGCAGG - Intronic
973606096 4:52589047-52589069 TGTCAGAAGAACTTTGAGGATGG + Intergenic
974369795 4:61000733-61000755 TTCCAGAAGAAGAGAGAGGAAGG + Intergenic
974642910 4:64654863-64654885 TTTCAGAAGCAGGAAGACAATGG - Intergenic
975418049 4:74129303-74129325 TTTTAGAATAAGGATGATGTGGG - Intronic
975875811 4:78835686-78835708 TCTGAGAAGAGGGATGAGGCAGG - Intronic
975897316 4:79108027-79108049 TTTCTGAACAAAGATGAGGTAGG - Intergenic
975969644 4:80017675-80017697 AATAGGAAGAAGGATGAGGAAGG + Intronic
976207930 4:82639892-82639914 TTTCAGAAGCAAGATGGGGGTGG - Intronic
976336416 4:83893244-83893266 TTTTAGGTGAAGGTTGAGGAAGG - Intergenic
976483629 4:85574242-85574264 TTTCATAATAAGGATAATGATGG - Intronic
976967914 4:91067638-91067660 TTAAAGAAGAAGGATGGGGTGGG - Intronic
977320397 4:95507598-95507620 TTTCAGGACAAGGATGAGACAGG - Intronic
977555740 4:98485883-98485905 TTGCTGAGGAAGGATGGGGATGG - Intronic
978020449 4:103803919-103803941 TTTCAGAAAACGGAAGAGAAGGG - Intergenic
978361600 4:107936427-107936449 TCTGAGAAGAAGGATGAGTTTGG + Intronic
978392531 4:108242142-108242164 TTTCAGGATTAGGAGGAGGAAGG + Intergenic
978850669 4:113332110-113332132 TTGCAGAAGAAGGAGAAGAATGG - Intronic
978919378 4:114164369-114164391 GTTCAGGATAAGGATGAGAATGG - Intergenic
979139436 4:117153318-117153340 TTGCACAGGAAGGATGAGGCAGG + Intergenic
980439763 4:132826081-132826103 TTTCAGAAAATTGAAGAGGAGGG - Intergenic
980912567 4:139006894-139006916 TCTCAAAAAAAGGAGGAGGATGG - Intergenic
981188154 4:141829931-141829953 TAGCAGAAGGAGGAAGAGGAAGG - Intergenic
981733373 4:147922801-147922823 AATCAGGAGAAGGATGAAGAAGG - Intronic
981917664 4:150052278-150052300 GTACAGCAGAAGGATGAGGCTGG - Intergenic
981947362 4:150363310-150363332 TTTCTGGGGAAGGTTGAGGAAGG - Intronic
982168245 4:152636048-152636070 CTCCAGAAGAAGGAAGAGGCTGG + Intronic
982444775 4:155477696-155477718 TTTGACAGGAAGGATAAGGATGG + Intergenic
982474983 4:155839403-155839425 TTCCAGAAGTAGGATGGGGAGGG + Intronic
983129200 4:163994346-163994368 TTTCAGAATATGGAAGGGGAAGG - Intronic
983443063 4:167812957-167812979 TTTAAGAAAGAAGATGAGGAAGG - Intergenic
983571676 4:169215480-169215502 TTTCAGAAGATAGATGCAGAGGG - Intronic
983978686 4:173968231-173968253 TTCCAGAAGAACGATCAGGCAGG - Intergenic
985208294 4:187564697-187564719 TTTCAGAAGAAGTAAGACAAAGG + Intergenic
986208364 5:5647319-5647341 GTTCAGTAGAAGGATTAGGCTGG - Intergenic
986314625 5:6578289-6578311 TTTTAGAGGATGGATGGGGAAGG - Intergenic
986832208 5:11592330-11592352 TTTTAGAAAAAAGAAGAGGAAGG - Intronic
987191279 5:15480877-15480899 GTTGAGGAGGAGGATGAGGATGG + Intergenic
987752674 5:22061571-22061593 TTTCAGAAGAATCCTGAGAAAGG - Intronic
988095046 5:26596044-26596066 TGCCAGAAGAAGCAAGAGGAAGG - Intergenic
988984402 5:36602780-36602802 TTTCAGAAGAGGACTGAGCAAGG - Intergenic
990196236 5:53319611-53319633 TTCCTGAAGGAGGAGGAGGATGG - Intergenic
990331269 5:54728297-54728319 TTTTTTAAGAAGGATAAGGAGGG + Intergenic
990470218 5:56108427-56108449 TTTCTGCAGAAGGATCAGGAAGG - Intronic
990722172 5:58708923-58708945 TTTAAGAAGAAAGACGAGGTAGG - Intronic
990802293 5:59618676-59618698 TTTCAGAAGACAGATGATGGTGG + Intronic
990971728 5:61514903-61514925 TTCCAGAAAATGGAAGAGGAGGG - Intronic
991000124 5:61774304-61774326 TTTCAGAAGAAGGGTGTTAAAGG - Intergenic
991230512 5:64328018-64328040 TTCCAGAAGGAGGAGGAAGAGGG + Intronic
991360315 5:65813199-65813221 TTTCAGGAGGAAGATGGGGAGGG - Intronic
991398488 5:66229125-66229147 GTTGAGAAGGAGGAGGAGGAGGG + Intergenic
991422841 5:66458895-66458917 TTTAAGAAGTAGGATTGGGAAGG - Intergenic
992161472 5:74008043-74008065 TTTCTCAAGCAGGATGATGAGGG - Intergenic
992274600 5:75102271-75102293 TTCCAGAGGAAGGATCAGGCAGG - Intronic
992908798 5:81374128-81374150 TTCCAGAGGAAGGAACAGGAGGG + Intronic
993097794 5:83500489-83500511 TTTCATGAGTAGAATGAGGAAGG + Intronic
993735254 5:91468805-91468827 TTTCAGAAAAAGGAAGTGGTAGG + Intergenic
993767813 5:91883137-91883159 TCTCAGAAGAAGGAAAAAGAGGG + Intergenic
994159135 5:96536055-96536077 TTAAAGAAAAAGGAGGAGGAGGG + Intronic
994545709 5:101163625-101163647 TTCCAGAGGAAGGATCAGGCAGG + Intergenic
994636639 5:102352086-102352108 TTCCAGAGGAAGGATCAGGCAGG + Intergenic
994744444 5:103661600-103661622 TTTCAGGAAAAGAATGAGGGTGG + Intergenic
995025446 5:107415719-107415741 TTGCACAAGAAAGATGAGTAGGG - Intronic
995735060 5:115291522-115291544 TTTCAGAAAATAGAGGAGGAAGG - Intronic
995772099 5:115681923-115681945 TTTCAATAAAAGGAAGAGGAAGG - Intergenic
995788348 5:115855852-115855874 TTTTAAAAGAATGATGAGGATGG + Intronic
996157106 5:120115433-120115455 TTTCAGAAGATGTATGAGAATGG + Intergenic
996942280 5:129022657-129022679 TTACAGAATAAAAATGAGGAGGG + Intronic
997534047 5:134602543-134602565 TTTCAAAAGAAGGATAATAATGG + Exonic
998163758 5:139828658-139828680 TTTCAGAAGCAGGATGAGGCAGG - Intronic
998326467 5:141284903-141284925 TTTTAGAAGATGGAGGAGCAGGG - Intergenic
998611516 5:143694313-143694335 TTTAAAAAGGAGGAGGAGGAGGG - Intergenic
999783555 5:154870716-154870738 TTTCAGAAGCATGAAGAGGAAGG + Exonic
1000058759 5:157633950-157633972 TGCAAGAAGAAGGAAGAGGAAGG + Intronic
1000572592 5:162934059-162934081 ATTCATAAGAAGGAATAGGAGGG - Intergenic
1001249623 5:170136733-170136755 TTTCCTAAGAATGATGAGGCAGG + Intergenic
1001735887 5:174000765-174000787 TTTAAGAAGGAGAATGAGGTGGG + Intronic
1002123805 5:177026305-177026327 CTTCAGAAACAAGATGAGGAAGG - Intronic
1002941630 6:1721873-1721895 TTTCAGAAACAGGATCAGAAAGG + Intronic
1003000520 6:2328014-2328036 TCTCAGAAGAAGAAGGGGGAAGG - Intergenic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003595530 6:7470937-7470959 TTTCAGTAGAGAGATGAGGGTGG - Intergenic
1003596260 6:7476811-7476833 TTTCAGTAGAGAGATGAGGGTGG + Intergenic
1003625738 6:7739753-7739775 TTTCAGCAGATGGATGGGGATGG - Intronic
1003955012 6:11154926-11154948 TTCCAGAAGAAGGTGGTGGATGG - Intergenic
1004262323 6:14118628-14118650 TGCCAGAGGAAGGAGGAGGAGGG - Intronic
1004717229 6:18229053-18229075 TTCCAGAGGAAGGATCAGGCAGG + Intronic
1005209024 6:23439449-23439471 TTTCAGAAAACAGAAGAGGAGGG - Intergenic
1005664440 6:28037161-28037183 TTTCAGATGAAGGCAGAGGTAGG - Intergenic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1006020652 6:31115830-31115852 TTTGAGAAGAGGAAGGAGGAAGG + Exonic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1006584267 6:35096061-35096083 TGTCAGAAGTGGGATGAGGCAGG + Intergenic
1006686016 6:35834888-35834910 TGCCAGCATAAGGATGAGGAGGG - Exonic
1006790463 6:36697948-36697970 TTTCTTTGGAAGGATGAGGATGG + Intronic
1007720809 6:43884548-43884570 TCTCAGAAGGAGGGTGAGCAAGG - Intergenic
1007958301 6:45936763-45936785 TTTGGGGAGAAGGATAAGGACGG - Intronic
1008123978 6:47648293-47648315 TTTCAGAAGTAGGAAGTCGAGGG - Intergenic
1008327944 6:50208043-50208065 TTTAAGAAGAAGGATACGGGAGG + Intergenic
1008652067 6:53573841-53573863 ATTTAAAAGAAGGATGAGGCAGG + Intronic
1008713748 6:54262786-54262808 TTTAAGAAAAAGAAGGAGGAGGG + Intronic
1008883912 6:56411157-56411179 TTTGAGGAGAAGGATGGGAATGG - Intergenic
1008994238 6:57639889-57639911 TTTCAGAATCAGGATGATGCTGG - Intronic
1009182837 6:60539003-60539025 TTTCAGAATCAGGATGATGCTGG - Intergenic
1009727779 6:67557703-67557725 TTCCAGAAGAAGGAACAGGAAGG - Intergenic
1009785046 6:68326039-68326061 TTTCAGAAAAAGGCTGGGGTAGG + Intergenic
1010756639 6:79672995-79673017 TTTCTGAAGAAGGCTGCTGAGGG + Intronic
1010918557 6:81651461-81651483 TTTCAGAAAGAGGATGTGTATGG - Intronic
1011266802 6:85529527-85529549 TTTCAGAGAAAGAACGAGGATGG + Intronic
1011506528 6:88050187-88050209 TTTCGCTAAAAGGATGAGGACGG - Intronic
1011786319 6:90849228-90849250 AGTCAGAAGAAGGATGGAGAAGG + Intergenic
1011919367 6:92552287-92552309 TAGCTGAGGAAGGATGAGGACGG + Intergenic
1012077333 6:94707029-94707051 TTTCAGGAGAATGATGAGGGTGG + Intergenic
1012486869 6:99731631-99731653 TTTCAGAAAATTGAAGAGGAAGG - Intergenic
1013003275 6:106046297-106046319 TTTCAGAAGAAGGAGGTGGTTGG + Intergenic
1013639141 6:112056428-112056450 CATCAAAAGAAGGAGGAGGAGGG - Intronic
1013878062 6:114858151-114858173 TTTCAGAATGGGGATGAGCATGG + Intergenic
1014317304 6:119883952-119883974 CTTGAGAAGAAGGATGAGTCTGG + Intergenic
1016087671 6:139934371-139934393 TTACAGAAGAAGAAAGAGCATGG + Intergenic
1016288673 6:142504141-142504163 TTTCAGTAGCAGGATGATGCTGG + Intergenic
1016738989 6:147508748-147508770 CATCAGAAGAAGCCTGAGGAAGG - Intergenic
1016875792 6:148863842-148863864 TTCCAGAAGAAGGATCAGGCAGG - Intronic
1017179153 6:151533710-151533732 CTTCAGATGAAGGAGGTGGAAGG - Intronic
1017507680 6:155083402-155083424 TTTCATAGGAAGGAGGAAGAGGG + Intronic
1018201516 6:161399624-161399646 TTTCAGCAGTAAGAAGAGGAAGG + Intronic
1018309001 6:162489094-162489116 TTTAGGAAAAAGGAAGAGGAAGG - Intronic
1018497516 6:164365068-164365090 TTCCAGAAAATTGATGAGGAAGG + Intergenic
1019125278 6:169835511-169835533 TTTCAGAAAATAGAAGAGGAAGG + Intergenic
1019600157 7:1878271-1878293 TTCCAGAAAAAAGAGGAGGAGGG + Intronic
1020252951 7:6483992-6484014 CTTCAGCAGCAGGATGACGATGG + Exonic
1020814030 7:12882280-12882302 TTTGGGAAGGAGGTTGAGGAAGG + Intergenic
1021343426 7:19491458-19491480 TTACAAAAAAGGGATGAGGAGGG - Intergenic
1021505499 7:21380083-21380105 TTCCACAAGAAGGATTAAGAGGG - Intergenic
1022574181 7:31481918-31481940 TTCCAGAAGAAGAATGAGAGAGG + Intergenic
1022771693 7:33480327-33480349 ATACAGAAGAAGGATAAAGAGGG + Intronic
1023220818 7:37918969-37918991 TGTGAGAAGAAGGATTAGGATGG - Intronic
1023276796 7:38528278-38528300 TTTCAGAAAATAGAAGAGGAGGG - Intronic
1023308148 7:38853121-38853143 TTTCATAAGAAGAATGTGGCCGG + Intronic
1023587406 7:41744892-41744914 ATTCAGAAGAAAGAAAAGGATGG - Intergenic
1024097374 7:45993604-45993626 TTTCAGAAGAATACAGAGGAGGG - Intergenic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024489563 7:49963834-49963856 TTTCAGAATACAGAAGAGGAAGG + Intronic
1024657451 7:51463665-51463687 TTTCAGTAGAATGATCTGGAGGG + Intergenic
1024800159 7:53067880-53067902 TTGAAAAAAAAGGATGAGGATGG + Intergenic
1025062796 7:55825668-55825690 TTTAAAAAGAAGGATGGGGCCGG + Intronic
1026180184 7:68032377-68032399 TTTCAGATGAATGTTAAGGATGG - Intergenic
1026768202 7:73173760-73173782 TTTCTGTAGAAGAATGAAGAAGG + Intergenic
1027044668 7:74983468-74983490 TTTCTGTAGAAGAATGAAGAAGG + Intronic
1027078970 7:75218891-75218913 TTTCTGTAGAAGAATGAAGAAGG - Intergenic
1027199618 7:76055234-76055256 TTTGAAAAGTAGTATGAGGATGG + Intronic
1027411134 7:77918945-77918967 TTGGAGAAGAAGGACAAGGAAGG + Intronic
1028134748 7:87213620-87213642 TTTAAGAACAAGGATCAGTAGGG - Intronic
1028414835 7:90568493-90568515 TTTCAGCTTACGGATGAGGAAGG - Intronic
1028720691 7:94027524-94027546 TTTGAGAAAAAAGATAAGGATGG - Intergenic
1029388190 7:100257451-100257473 TTTCTGTAGAAGAATGAAGAAGG - Intronic
1029930580 7:104366287-104366309 TTTGAGAAGATGGAGGAAGAGGG + Intronic
1030838649 7:114320053-114320075 GTTCAGTAGAAGAATGAGGTGGG + Intronic
1030855494 7:114550410-114550432 CTTCAAAAGAAAGATGAGGCCGG - Intronic
1031039465 7:116823862-116823884 TTTCAGAAAATTGAGGAGGAGGG - Intronic
1031072668 7:117179634-117179656 TTAGAGCAGAGGGATGAGGAGGG + Intronic
1031484670 7:122312091-122312113 CTTGCGAAGACGGATGAGGAGGG + Intergenic
1031595460 7:123644751-123644773 ATTAAGAAGAATGATGTGGAAGG - Intergenic
1031915544 7:127559682-127559704 GTTCAGAAGAAGGTGGAGGCTGG - Intergenic
1032945237 7:136844286-136844308 TTTCTGAAGGATGAAGAGGAAGG + Intergenic
1033071569 7:138208087-138208109 GTTCAGAACAAAGATGAAGACGG - Intergenic
1033921958 7:146404757-146404779 CTCCAGCAGAAGGACGAGGAGGG - Intronic
1033937696 7:146607776-146607798 TTTAAGAAGAAAGATGGTGAAGG - Intronic
1034753301 7:153591047-153591069 TTTCAGCAGAAGGACCAGGTGGG + Intergenic
1034997024 7:155584065-155584087 ATCCAGAAGAGGGAGGAGGATGG - Intergenic
1035257157 7:157637737-157637759 TTTCAGAAGAAGGATGAGGAGGG + Intronic
1036731136 8:11265929-11265951 TTTTTGAAGAAAAATGAGGAGGG - Intergenic
1037300263 8:17444063-17444085 GATCAGAAGGAGGAGGAGGAGGG - Intergenic
1037512092 8:19593877-19593899 TTTCAGCACAAGGTTGAGAAGGG - Intronic
1037631070 8:20656873-20656895 TTGGATAAGAAGGGTGAGGAGGG - Intergenic
1038057729 8:23876871-23876893 TATCAGAAGATGCTTGAGGAAGG + Intergenic
1038679678 8:29655197-29655219 TTTCAGCAGAAGAATGAGCTGGG - Intergenic
1038752268 8:30306316-30306338 TTTCAGCAGAAGGATGATAAAGG + Intergenic
1039343153 8:36673099-36673121 GTTCAGATGATAGATGAGGATGG - Intergenic
1040107644 8:43549533-43549555 TTTCAGAAGGATGTTGAGGCAGG - Intergenic
1040111992 8:43570735-43570757 TTTCAGGGGGAGGTTGAGGAAGG - Intergenic
1040434033 8:47372169-47372191 GTACAGAAGAAGGATCAGAAAGG - Intronic
1040659288 8:49550903-49550925 TTGCAGAAAATGGAAGAGGATGG - Intronic
1041733211 8:61083750-61083772 TTTCAGAAGAAGAAAAAAGATGG + Intronic
1042395661 8:68289136-68289158 GATCAGAACAAGGTTGAGGAGGG - Intergenic
1043240245 8:77924474-77924496 TTTCAAAAAAATGAGGAGGAGGG + Intergenic
1043360275 8:79464073-79464095 TTTGAGAACAAGAAAGAGGATGG - Intergenic
1043410940 8:79994643-79994665 TTTCGGAAGAAGGATGTGAGAGG - Intronic
1044431368 8:92111622-92111644 CTGCTGAAGAAGGATGAGAAGGG - Intergenic
1044487073 8:92766553-92766575 TTGCAGAAGAGGTATGTGGATGG - Intergenic
1045686662 8:104719827-104719849 TTTAAGTAGAAGAGTGAGGAGGG + Intronic
1046518646 8:115296097-115296119 TTTCAGAAGATTGATGAAGAAGG - Intergenic
1047002137 8:120583702-120583724 TTTCAGAAAATGGAAGAGTAGGG + Intronic
1047700861 8:127448131-127448153 TTTCACAGGGAGGAAGAGGAAGG + Intergenic
1047880686 8:129189643-129189665 TTTGAGAAGATGGATGAACAAGG + Intergenic
1048238619 8:132718071-132718093 TTTCAGGAGGTGGAAGAGGAAGG + Intronic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1050389790 9:5129443-5129465 TTTCAGTACAAGAATTAGGATGG - Intergenic
1050751054 9:8937702-8937724 TTTTGTAAGAAGGAGGAGGAAGG - Intronic
1051138344 9:13949989-13950011 TTGCCTTAGAAGGATGAGGATGG + Intergenic
1051656868 9:19390813-19390835 TTTCAGAAAATAGAAGAGGAAGG + Intergenic
1051662231 9:19436252-19436274 TTTCAGACTAAAGATGGGGAGGG - Intronic
1051840340 9:21389987-21390009 TTTCATAATATTGATGAGGAAGG + Intergenic
1052098883 9:24418791-24418813 TTTCAGAACAGGAATGAGGGAGG + Intergenic
1052582176 9:30372586-30372608 TTTCAGAAAATTGAAGAGGAGGG + Intergenic
1052783670 9:32807958-32807980 TTTCAGAAGACAGAAGAAGAGGG + Intergenic
1053164049 9:35832302-35832324 GTCCAGAAGAAGCATGAGTAAGG - Intronic
1053476416 9:38385164-38385186 TGACAGTAGAAGGGTGAGGATGG - Intergenic
1053648638 9:40140851-40140873 TTTCAGAGGATGTATGAGAAAGG - Intergenic
1053757108 9:41322991-41323013 TTTCAGAGGATGTATGAGAAAGG + Intergenic
1054329619 9:63738796-63738818 TTTCAGAGGATGTATGAGAAAGG - Intergenic
1054535945 9:66235319-66235341 TTTCAGAGGATGTATGAGAAAGG + Intergenic
1054703757 9:68441239-68441261 TTCCAGAAAAAGGAAGAAGATGG + Intronic
1054985895 9:71261853-71261875 TTTCAGAGGAAGGAGCAGGCAGG - Intronic
1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG + Intergenic
1056925510 9:90830879-90830901 TTTCATAAGAAAGAGGAGGCCGG - Intronic
1057558213 9:96105874-96105896 TTTCAGAAGATAGATGAAAAGGG + Intergenic
1058273371 9:103005349-103005371 GATGAAAAGAAGGATGAGGATGG + Exonic
1058473979 9:105311908-105311930 TTTCAGGAGAAAGAAGAGGATGG - Intronic
1059599890 9:115765578-115765600 TTACAGAAAAAGAAAGAGGATGG - Intergenic
1060046031 9:120341819-120341841 GCTCAGAAGAAGGAGGAGGAGGG + Intergenic
1060378049 9:123136339-123136361 TTTGAGAAGAAAGATAAGGCTGG + Intronic
1061224996 9:129276315-129276337 CTACTCAAGAAGGATGAGGAGGG - Intergenic
1061787095 9:133036041-133036063 TTGCAGAAGGAGGGTCAGGAAGG - Intronic
1061998185 9:134199373-134199395 TTCCAGAAAATGGAAGAGGAGGG + Intergenic
1202796402 9_KI270719v1_random:124149-124171 TTTCAGAGGATGTATGAGAAAGG - Intergenic
1185718271 X:2360921-2360943 TTTCAGAGGAAGGATGGAGCTGG + Intronic
1185815174 X:3148334-3148356 TTGGAGAAGAAAGATGAAGAGGG + Intergenic
1185868358 X:3642481-3642503 GCACAGGAGAAGGATGAGGATGG + Intronic
1186004886 X:5058529-5058551 TTTAAGAAGAAGGCTGGGCAAGG - Intergenic
1187386009 X:18849125-18849147 TTTTAGCAGAAGGCTGAGCAGGG + Intergenic
1188389455 X:29601749-29601771 TTCCAGAATAAGAAAGAGGATGG + Intronic
1188499723 X:30811857-30811879 TTATAAAAGAAGGATGAGGCAGG - Intergenic
1189236244 X:39489491-39489513 TGTCAGAAGAGGGCTGAGGTTGG - Intergenic
1189783765 X:44541706-44541728 AATCAAAAGAAGGATGAGGAGGG + Intronic
1190299081 X:49045741-49045763 TTACAAAAGAAGAAAGAGGAGGG + Intergenic
1191254661 X:58274555-58274577 TTTCAGAGGGAGGTTGAGGCAGG - Intergenic
1191255700 X:58278682-58278704 TTTCAGAGGGAGGTTGAGGCAGG - Intergenic
1191256544 X:58282005-58282027 TTTCAGAAGGAGGTTGAAGCAGG - Intergenic
1191256696 X:58282574-58282596 TTTCAGGAGGAGGTTGAGGCAGG - Intergenic
1191257347 X:58285377-58285399 TTTCAGGAGGAGGTTGAGGGAGG - Intergenic
1191810674 X:65184128-65184150 TGTCAGGAAAAGGAAGAGGAAGG - Intergenic
1191874726 X:65784623-65784645 TTTCAGAGGCATTATGAGGAAGG - Intergenic
1192296829 X:69858766-69858788 TTTCAAAAAAATGATGAGGAGGG - Intronic
1192892240 X:75402836-75402858 TTCCAGAAAAATGAGGAGGAAGG + Intronic
1193007983 X:76642720-76642742 TTAAAGAAGAAGAATGAGAAAGG + Intergenic
1194048159 X:89034815-89034837 GTTCAGAAGAAGGAAGTGGTGGG + Intergenic
1194547052 X:95249603-95249625 TTTAAGAAGAAATGTGAGGAAGG + Intergenic
1194972634 X:100360960-100360982 TTTGGGAAGGGGGATGAGGAGGG + Intronic
1195077385 X:101339970-101339992 TTTCAGAAAATGGCTGAGGTGGG + Intergenic
1195689328 X:107610927-107610949 TTTAGCAAGGAGGATGAGGATGG - Intergenic
1195850192 X:109274450-109274472 TCTGACAAGAACGATGAGGATGG - Intergenic
1195932787 X:110096025-110096047 TTCCAGAGGAAGGATCAGGCAGG - Intronic
1196019198 X:110972352-110972374 TTCCAGAGGAAGGATCAGGCAGG + Intronic
1196473429 X:116054950-116054972 TTTCAGAATCAGGATGATGGTGG + Intergenic
1196746701 X:119077633-119077655 TTTCTAAAGCAGGAGGAGGAAGG + Intergenic
1197329975 X:125141639-125141661 TAACAGAAGAGGAATGAGGAAGG + Intergenic
1198204187 X:134450873-134450895 GTACAGAAGGAGGATCAGGAAGG + Intergenic
1198244662 X:134818576-134818598 TTTCAGTAGAAGGAGGAGTGGGG + Intronic
1198584581 X:138106057-138106079 TTCCAGAGGAAGGATCAGGCAGG + Intergenic
1198639407 X:138740569-138740591 TTTCAGCAGTAGGCAGAGGATGG + Intronic
1198853183 X:140987473-140987495 TTTCTTGAGAAGGATCAGGAGGG + Intergenic
1199116492 X:143998633-143998655 TTTGGGAAGAAGTATGTGGATGG - Intergenic
1199232568 X:145454593-145454615 TTCCAGAAAATGGAAGAGGAGGG + Intergenic
1199496693 X:148460068-148460090 GTTCAGGAGAAGGATGGGGGAGG - Intergenic
1199680712 X:150222462-150222484 ATTCAGAAAAAGGAGAAGGAAGG + Intergenic
1201300204 Y:12498611-12498633 AATAAGAAGAAGGAGGAGGAGGG - Intergenic
1201367630 Y:13225730-13225752 TTTCAGTGGATGGATGAGAAAGG + Intergenic
1202142163 Y:21736311-21736333 TTTGAAAAGAAGGAAGAAGAGGG - Intergenic
1202144702 Y:21767491-21767513 TTTGAAAAGAAGGAAGAAGAGGG + Intergenic