ID: 1035257898

View in Genome Browser
Species Human (GRCh38)
Location 7:157643694-157643716
Sequence TGGGTGCGGGTGTCTGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 368}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035257898_1035257911 2 Left 1035257898 7:157643694-157643716 CCCCCTGCAGACACCCGCACCCA 0: 1
1: 0
2: 4
3: 33
4: 368
Right 1035257911 7:157643719-157643741 GTAAAGGAGGTGGGAGCAGGCGG 0: 1
1: 0
2: 5
3: 66
4: 790
1035257898_1035257912 7 Left 1035257898 7:157643694-157643716 CCCCCTGCAGACACCCGCACCCA 0: 1
1: 0
2: 4
3: 33
4: 368
Right 1035257912 7:157643724-157643746 GGAGGTGGGAGCAGGCGGCCAGG 0: 1
1: 1
2: 13
3: 100
4: 889
1035257898_1035257907 -7 Left 1035257898 7:157643694-157643716 CCCCCTGCAGACACCCGCACCCA 0: 1
1: 0
2: 4
3: 33
4: 368
Right 1035257907 7:157643710-157643732 GCACCCACAGTAAAGGAGGTGGG No data
1035257898_1035257913 18 Left 1035257898 7:157643694-157643716 CCCCCTGCAGACACCCGCACCCA 0: 1
1: 0
2: 4
3: 33
4: 368
Right 1035257913 7:157643735-157643757 CAGGCGGCCAGGCTCCAGCCAGG No data
1035257898_1035257910 -1 Left 1035257898 7:157643694-157643716 CCCCCTGCAGACACCCGCACCCA 0: 1
1: 0
2: 4
3: 33
4: 368
Right 1035257910 7:157643716-157643738 ACAGTAAAGGAGGTGGGAGCAGG No data
1035257898_1035257906 -8 Left 1035257898 7:157643694-157643716 CCCCCTGCAGACACCCGCACCCA 0: 1
1: 0
2: 4
3: 33
4: 368
Right 1035257906 7:157643709-157643731 CGCACCCACAGTAAAGGAGGTGG 0: 1
1: 0
2: 0
3: 13
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035257898 Original CRISPR TGGGTGCGGGTGTCTGCAGG GGG (reversed) Intronic