ID: 1035259455

View in Genome Browser
Species Human (GRCh38)
Location 7:157652448-157652470
Sequence CAGCTCTGACACCTTGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035259453_1035259455 11 Left 1035259453 7:157652414-157652436 CCTGGGACACAGCACCTGCAACA 0: 1
1: 0
2: 2
3: 36
4: 377
Right 1035259455 7:157652448-157652470 CAGCTCTGACACCTTGCTGATGG No data
1035259454_1035259455 -3 Left 1035259454 7:157652428-157652450 CCTGCAACAGCAAAGCGTCTCAG 0: 1
1: 0
2: 0
3: 14
4: 82
Right 1035259455 7:157652448-157652470 CAGCTCTGACACCTTGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035259455 Original CRISPR CAGCTCTGACACCTTGCTGA TGG Intronic
No off target data available for this crispr