ID: 1035265588

View in Genome Browser
Species Human (GRCh38)
Location 7:157688965-157688987
Sequence GGCCGCAGCACCCTCCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 274}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035265588_1035265597 13 Left 1035265588 7:157688965-157688987 CCGGCGCGGAGGGTGCTGCGGCC 0: 1
1: 0
2: 3
3: 17
4: 274
Right 1035265597 7:157689001-157689023 ACAGAGCGCGCCGGCCGCGAGGG No data
1035265588_1035265600 23 Left 1035265588 7:157688965-157688987 CCGGCGCGGAGGGTGCTGCGGCC 0: 1
1: 0
2: 3
3: 17
4: 274
Right 1035265600 7:157689011-157689033 CCGGCCGCGAGGGAGGACCAAGG No data
1035265588_1035265596 12 Left 1035265588 7:157688965-157688987 CCGGCGCGGAGGGTGCTGCGGCC 0: 1
1: 0
2: 3
3: 17
4: 274
Right 1035265596 7:157689000-157689022 CACAGAGCGCGCCGGCCGCGAGG No data
1035265588_1035265598 16 Left 1035265588 7:157688965-157688987 CCGGCGCGGAGGGTGCTGCGGCC 0: 1
1: 0
2: 3
3: 17
4: 274
Right 1035265598 7:157689004-157689026 GAGCGCGCCGGCCGCGAGGGAGG No data
1035265588_1035265593 4 Left 1035265588 7:157688965-157688987 CCGGCGCGGAGGGTGCTGCGGCC 0: 1
1: 0
2: 3
3: 17
4: 274
Right 1035265593 7:157688992-157689014 CTCCTGGCCACAGAGCGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035265588 Original CRISPR GGCCGCAGCACCCTCCGCGC CGG (reversed) Intronic
900134113 1:1106982-1107004 GGCCTCAGCTGCCTCCACGCGGG + Intronic
900242562 1:1624010-1624032 GGAGGCAGCACCCTCCCCGAAGG - Intronic
900266668 1:1760585-1760607 GTCCCCAGCAGCCTGCGCGCTGG + Intronic
900548202 1:3240532-3240554 GGCCTCAGCCTCCTCCGCACCGG + Intronic
901045448 1:6393223-6393245 GGCCGCTGCAGGCTGCGCGCGGG + Intronic
901055544 1:6447313-6447335 CGCCGCGGCGCCCCCCGCGCGGG + Intronic
901109960 1:6785942-6785964 GGCCCCCGCACCCCCGGCGCTGG + Intronic
901238580 1:7680308-7680330 GGCCGATTCTCCCTCCGCGCTGG + Intronic
901249991 1:7771047-7771069 GTCCGCACCGCCGTCCGCGCTGG - Intergenic
901540108 1:9910136-9910158 GGCCGCCGCGCGCTGCGCGCCGG - Exonic
903115643 1:21176611-21176633 GGCAGCAGCAGCCGCCCCGCGGG + Intronic
903233924 1:21937483-21937505 GCCCCCAGCCCCCTCCGCGCGGG + Intergenic
903749085 1:25608603-25608625 GGCAGCTGCACCCTCCGCCAGGG - Intergenic
905168548 1:36097546-36097568 GGCAGCAGGACCCCCCCCGCGGG + Exonic
905761131 1:40559023-40559045 GGCCTCAGCTGCCTCCCCGCGGG - Intergenic
908299941 1:62753649-62753671 GGCCTCAGCCGCCTCCCCGCTGG + Intergenic
908951669 1:69568662-69568684 CCCCGCAGCACCCTCCGCCACGG - Intronic
912993426 1:114510897-114510919 GGCCGCGCCGCCCTCAGCGCCGG + Exonic
912993454 1:114510980-114511002 GGCCGCCGGGCCCGCCGCGCAGG - Exonic
913250831 1:116910595-116910617 GACCGCAGCACCTTCCGGGCCGG - Intronic
915740206 1:158113479-158113501 GGCCGCGGCAGCCACCGAGCGGG - Intergenic
916666941 1:166975388-166975410 GGGCGCAGCGCCCGCCGGGCCGG + Intronic
916666982 1:166975543-166975565 CGCCGCAGAGCCCGCCGCGCGGG + Intergenic
918542677 1:185649070-185649092 GGCCTCAGCCACCTCCCCGCGGG - Intergenic
918942964 1:191026137-191026159 GGCCTCAGCCGCCTCCCCGCAGG - Intergenic
919903163 1:202058737-202058759 GGAAGCAGCACCCTCAGGGCTGG - Intergenic
920029200 1:203026515-203026537 GGCTGCAGCTACCTCGGCGCCGG + Intronic
920178353 1:204117244-204117266 GTCCCCAGCACCCTCCAGGCCGG - Intronic
920878438 1:209858797-209858819 GGCCTCAGCTGCCTCCTCGCGGG - Intergenic
921345971 1:214185502-214185524 GGCTGCAGCAGCCTCCCTGCTGG - Intergenic
921556216 1:216601315-216601337 GCGCGCAGCGCCCTCCGCGGTGG - Intronic
922250578 1:223845816-223845838 GTCCGAAGGGCCCTCCGCGCGGG + Exonic
923500051 1:234557050-234557072 GGGCACACCACCCTCCCCGCAGG + Intergenic
923810505 1:237309769-237309791 GGCCTCAGCTGCCTCCCCGCAGG - Intronic
924313762 1:242774511-242774533 GGCCTCAGCTGCCTCCCCGCAGG - Intergenic
924423629 1:243931607-243931629 AGCCGCTGCGCCCTCCCCGCGGG + Intergenic
924944553 1:248837906-248837928 TGCCGCGGCCCCGTCCGCGCCGG + Intergenic
1063138927 10:3239726-3239748 GGCCGCAGCACCCTACGCCCCGG + Intergenic
1067269043 10:44773762-44773784 CGTCCCTGCACCCTCCGCGCTGG - Intergenic
1067513909 10:46920533-46920555 GCCCCCAGCACCCTCTGCTCTGG - Intronic
1067648345 10:48131299-48131321 GCCCCCAGCACCCTCTGCTCTGG + Intergenic
1068554943 10:58448407-58448429 GGCCTCAGCTGCCTCCCCGCGGG - Intergenic
1069090792 10:64196917-64196939 GGCCCCAGCTGCCTCCCCGCAGG - Intergenic
1071610988 10:87031123-87031145 GGCCTCAGCCACCTCCCCGCGGG - Intergenic
1073139691 10:101238953-101238975 GGCCGCCGCGCTCCCCGCGCGGG + Intergenic
1073487169 10:103826917-103826939 GGCCGAAGCATCCTCCAGGCAGG - Intronic
1074547058 10:114409255-114409277 AACCGCAGCACCCTCCCTGCAGG + Intergenic
1074815410 10:117138220-117138242 GGCCGCCGAAGCCTCCCCGCGGG - Intronic
1074864153 10:117535283-117535305 TCCCGCAGCTCTCTCCGCGCAGG + Intergenic
1076401610 10:130188999-130189021 GGCGGGAGCACCCACCCCGCTGG + Intergenic
1080456994 11:32427375-32427397 GGCCAGAGCAGCCTCCCCGCAGG + Intronic
1083714466 11:64567738-64567760 GGCCGCCGCACCATCCAGGCGGG + Exonic
1084179078 11:67437622-67437644 GTCCGCAGGCCCCTCCGTGCCGG + Exonic
1084438560 11:69157804-69157826 GGCAGCAGCAGCCTCTGCCCTGG - Intergenic
1084588858 11:70078815-70078837 GGGGGCCGCACCCTCCGCGCAGG + Intronic
1084642640 11:70434878-70434900 GGCAGCAGGAGCCTCCGCGGTGG + Intronic
1085518849 11:77126583-77126605 GCCCTCAGCAGCCTCCGCTCTGG - Intergenic
1088250674 11:107858705-107858727 GGCCGCCGCTCCCTCCGCGAGGG + Exonic
1090190394 11:124762764-124762786 GGCCGGAGCGCCGGCCGCGCGGG + Intergenic
1090230813 11:125102242-125102264 GGCCGCCGCTGCCTCCCCGCGGG - Exonic
1090699052 11:129278844-129278866 TGCCGCAGCGCTCTCCGCCCCGG - Intronic
1090699077 11:129278941-129278963 GCCCGCAGCGCCGTCCGCCCCGG + Intronic
1095810642 12:46371346-46371368 GGCCGCTGCACCCACCGCCAAGG - Exonic
1096024681 12:48350753-48350775 AGCCGCAGCTCCCTCCGGCCCGG + Exonic
1098320596 12:69239733-69239755 GGCCGCAGCGCCGCCCGCGTCGG - Intronic
1100679832 12:96907255-96907277 GGCCGCGGCCGGCTCCGCGCTGG - Intronic
1101612209 12:106302534-106302556 GACCGCACCACTCGCCGCGCGGG + Intronic
1101917924 12:108910588-108910610 GGCTGCAGCCCCCTCCGCCCAGG - Intergenic
1103764468 12:123271103-123271125 GCCCGCAGCGCCCCCCGCCCGGG + Intronic
1104373894 12:128247460-128247482 GGCCTCAGCCGCCTCCCCGCAGG + Intergenic
1104961145 12:132489384-132489406 GGCAGCAGCCCCCGCCTCGCTGG + Intergenic
1104973723 12:132542756-132542778 GGGAGCAGCAACCTCAGCGCAGG + Intronic
1107601157 13:42013904-42013926 TGCCGAAGCACACTCCGCGGAGG + Intergenic
1107601162 13:42013929-42013951 AGCCGAAGCACACTCCGCGGAGG + Intergenic
1108991126 13:56659256-56659278 GGCCTCAGCTGCCTCCCCGCGGG - Intergenic
1110440211 13:75518770-75518792 GGCCTCAGCCACCTCCCCGCAGG + Intergenic
1110854188 13:80278795-80278817 GGCCTCAGCTGCCTCCCCGCGGG - Intergenic
1113378632 13:109784820-109784842 GGCCGCCGCAGCCGCCGCTCAGG + Exonic
1114224194 14:20723438-20723460 GCCCGCAGCCTCCCCCGCGCGGG - Intergenic
1116152103 14:41154383-41154405 GGCCTCAGCCGCCTCCCCGCGGG - Intergenic
1118366573 14:65102042-65102064 GGCCGCAGCACCCTCCCGCAAGG + Intronic
1118514310 14:66508868-66508890 CCCCGCAGCGCCCTCCGCACCGG - Intronic
1121333272 14:93061304-93061326 GGCTGAAGCACCCTCGGTGCTGG + Intronic
1122542686 14:102506913-102506935 GCCCGGAGCACCCTAGGCGCTGG - Exonic
1122631683 14:103110129-103110151 GGCCTCCGCACCCGCCGCCCCGG - Exonic
1122788155 14:104173402-104173424 GCCCGCAGCACCAGCCGAGCGGG + Exonic
1122829537 14:104389093-104389115 GTCCTCAGCACCCTCCGCCCTGG + Intergenic
1123162049 14:106287730-106287752 GGCCGCCGCACGTGCCGCGCGGG - Intergenic
1124211842 15:27770494-27770516 GGCTCCAGGACCCTCCCCGCAGG + Intronic
1124629238 15:31327535-31327557 GGCCGCCGCGCCTTCGGCGCCGG - Exonic
1125300987 15:38252968-38252990 GGCGGCAGCAACCTCCGCCGTGG - Exonic
1125510547 15:40290340-40290362 GGCCTCAGCTCCCTCCCTGCAGG + Intronic
1129703951 15:77783999-77784021 GGGCGCAGCACCGTCCTCCCTGG - Intronic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1132409997 15:101569423-101569445 GGCCGCATCAGCCTCCCTGCTGG + Intergenic
1132650894 16:1021073-1021095 GGCCGCAGCCCACTCCCAGCAGG + Intergenic
1132651938 16:1025257-1025279 GACCTCAGCACCCTCCAAGCCGG - Intergenic
1132651946 16:1025281-1025303 GACCTCAGCACCCTCCAAGCCGG - Intergenic
1132651954 16:1025305-1025327 GACCTCAGCACCCTCCAAGCCGG - Intergenic
1132651962 16:1025329-1025351 GACCTCAGCACCCTCCAAGCCGG - Intergenic
1132651970 16:1025353-1025375 GACCTCAGCACCCTCCACGCCGG - Intergenic
1132651978 16:1025377-1025399 GACCTCAGCACCCTCCAAGCCGG - Intergenic
1132651993 16:1025425-1025447 GACCTCAGCACCCTCCAAGCCGG - Intergenic
1132652008 16:1025473-1025495 GACCTCAGCACCCTCCAAGCCGG - Intergenic
1132652022 16:1025521-1025543 GACCTCAGCACCCTCCAAGCCGG - Intergenic
1132652030 16:1025545-1025567 GACCTCAGCACCCTCCACACCGG - Intergenic
1132652038 16:1025569-1025591 GACCTCAGCACCCTCCAAGCCGG - Intergenic
1132652046 16:1025593-1025615 GACCTCAGCACCCTCCACACCGG - Intergenic
1132652054 16:1025617-1025639 GACCTCAGCACCCTCCACACCGG - Intergenic
1132934580 16:2474214-2474236 GGCCGCCGCCCCGTCCCCGCCGG + Intergenic
1132989475 16:2785545-2785567 GGCAGCAGCACCCGTCGCACGGG + Exonic
1133056877 16:3149799-3149821 GGCCGCCGCACCCTCAGGCCTGG - Exonic
1140068077 16:71626710-71626732 GGGCGCTGCGACCTCCGCGCCGG + Intronic
1141648342 16:85379180-85379202 GGCCTCAGCACCCTCCTCGCTGG + Intergenic
1142305790 16:89284682-89284704 GGGGACAGCGCCCTCCGCGCTGG + Exonic
1142395508 16:89829054-89829076 GGGAGCAGCCCGCTCCGCGCTGG - Intronic
1144809950 17:17992645-17992667 GGCCACAGCACCATCAGCACTGG - Intronic
1145050290 17:19654458-19654480 GGCCTCAGCCACCTCCCCGCAGG - Intronic
1147907676 17:43833306-43833328 CACCGCCGCACCCTCCGGGCCGG + Intergenic
1148785352 17:50143612-50143634 GGCCGCACCACCCTCCGTCACGG + Exonic
1150983361 17:70168992-70169014 GGGCGCTGCAGCCTCCGCGGGGG + Intronic
1152356485 17:79810097-79810119 CGCCGCGGCCCCCTCCCCGCCGG + Intergenic
1152624530 17:81382160-81382182 AGCTGCTGCACCCTCGGCGCTGG + Intergenic
1152769060 17:82156525-82156547 GGCCACAGCCCCCACCGGGCAGG + Intronic
1152852964 17:82648416-82648438 GGCCGCGGCGGCCTCAGCGCCGG - Exonic
1152925615 17:83086367-83086389 GGCCTCAGCACCCGCAGGGCTGG + Intronic
1155611689 18:27674007-27674029 GGCCTCAGCTGCCTCCCCGCAGG - Intergenic
1157575335 18:48739615-48739637 GGGTGCAGCACCCTCAGCACAGG - Intronic
1159289338 18:66396040-66396062 GGCCTCAGCTGCCTCCCCGCAGG + Intergenic
1160448742 18:78947442-78947464 GGCCCCAGCAACCTCAGGGCAGG - Intergenic
1160887984 19:1360887-1360909 GGCCGCACCATCCCCCGGGCCGG + Exonic
1161975686 19:7606769-7606791 GGCCTCAGTGCCCTACGCGCTGG + Exonic
1162987116 19:14277824-14277846 GGCCTCAGCTACCTCCCCGCCGG + Intergenic
1163012250 19:14433474-14433496 GGCCGCCCCTCCCTCCGCGCGGG + Intronic
1163847311 19:19645105-19645127 GGTCCCAGCACCCTCCCCACAGG - Intergenic
1164036866 19:21463446-21463468 GACCGCAGCTCCTTCCACGCAGG + Intronic
1165102409 19:33446749-33446771 GGCCTCACCACCCTCGGTGCGGG - Intronic
1165103992 19:33457951-33457973 GCCCCCAGCACCCTCGGCTCGGG + Intronic
1165157712 19:33797974-33797996 GGCCGCGGCACCCGAAGCGCGGG - Intronic
1165475129 19:36026136-36026158 GGTGGCAGTACCCTCAGCGCAGG + Exonic
1167501636 19:49851574-49851596 GTCCGCAGCCCCCGCCGCTCCGG + Intronic
1168101074 19:54141271-54141293 AGCCGCAGCAGCCCCCGCCCAGG - Intronic
924967391 2:91209-91231 GGCCTCAGCTGCCTCCCCGCGGG + Intergenic
925609632 2:5692503-5692525 GACCGCAGCTCCCACCGCGCCGG + Intergenic
926101845 2:10122903-10122925 GCCCGCAGCGCCCTCCCCGCGGG - Intronic
927596603 2:24403077-24403099 GGCCTCAGCCGCCTCCCCGCAGG + Intergenic
927942177 2:27111653-27111675 GGCCTCAGCTGCCTCCCCGCGGG - Intronic
928688576 2:33775569-33775591 GGCCTCAGCCGCCTCCCCGCGGG + Intergenic
929138001 2:38643211-38643233 GGCCTCAGCTGCCTCCTCGCGGG - Intergenic
929563414 2:42969707-42969729 GGCTGCAGCACCCTCACCTCTGG - Intergenic
929575044 2:43046294-43046316 GGCAGCAGAAGCCTCCGAGCCGG + Intergenic
930420870 2:51151761-51151783 GGCCTCAGCTGCCTCCCCGCGGG - Intergenic
933139828 2:78779212-78779234 GGCCTCAGCCGCCTCCCCGCGGG + Intergenic
935878346 2:107536233-107536255 GGCCTCAGCTGCCTCCCCGCAGG - Intergenic
936428114 2:112436377-112436399 GGTCCCAGCACCCACCGCACTGG + Intergenic
942170236 2:173282731-173282753 GGCCTCAGCTGCCTCCGCGCGGG - Intergenic
942368654 2:175257145-175257167 GGCCTCAGCCGCCTCCCCGCGGG - Intergenic
945664213 2:212721212-212721234 GGCCTCAGCTGCCTCCCCGCGGG - Intergenic
946255234 2:218437168-218437190 GGCCGCAGCAACCACTGCACAGG + Exonic
948614446 2:239189739-239189761 GGCCCCAGCACACTCCGCGGAGG + Intronic
948625569 2:239266055-239266077 TGCCACAGCAGCCTCTGCGCAGG - Intronic
949014563 2:241702153-241702175 TGCCGCAGCCCCCCGCGCGCCGG + Intronic
949037072 2:241820879-241820901 GGCTGGAGCACCCTCTGAGCTGG + Intergenic
1169340888 20:4795437-4795459 TGCCCCAGCACCCTCCCCACTGG - Intronic
1172888224 20:38246042-38246064 GGCCACAGCACCCACCGTCCTGG - Exonic
1173198329 20:40934401-40934423 GGCTGCAGCAGCCTCCTCCCTGG - Intergenic
1174049195 20:47755881-47755903 GGCCCCAGCTCCCTCCACTCCGG + Intronic
1175944190 20:62551126-62551148 ACCCGCAGCACCCACCTCGCTGG - Intronic
1175951923 20:62588135-62588157 GGCCGCAGCACTCTCTGCCTTGG - Intergenic
1176008819 20:62880974-62880996 GGCAGCAGCACCCTCCGGGCAGG + Exonic
1176374141 21:6078834-6078856 GGTCCCAGCACCCACCGCACTGG - Intergenic
1178992250 21:37366298-37366320 GCCCGCAGCCCCGCCCGCGCCGG - Intronic
1179749336 21:43459411-43459433 GGTCCCAGCACCCACCGCACTGG + Intergenic
1180109853 21:45642829-45642851 GGCCGCAGCGCCCGGCGGGCAGG - Intergenic
1180981276 22:19879275-19879297 GGCCGCAGGCCCCACCGCCCAGG + Intronic
1181595871 22:23914050-23914072 GTCCCCAGCATGCTCCGCGCGGG + Intergenic
1184046831 22:41977102-41977124 GGCCGCAGCCTCCTCCTGGCGGG - Intronic
1184566605 22:45295737-45295759 GGCAGCAGCATCCTCCTCTCTGG + Exonic
1185129784 22:49032383-49032405 GGTCCCAGCACCCTCCGGCCTGG - Intergenic
1185229102 22:49670344-49670366 GGCCTCAGCTGCCTCCCCGCGGG - Intergenic
1185258777 22:49850196-49850218 GCCCTCAGGACCCTCCGCGTGGG + Intergenic
1185281598 22:49972170-49972192 CGCCGCAGACCCCTCCCCGCAGG - Intergenic
1185351562 22:50342378-50342400 GTCAGCAGCACCCTCCTCGCCGG - Intergenic
1185374231 22:50474771-50474793 GGCCTCGGCACTCACCGCGCGGG + Exonic
1185380850 22:50506987-50507009 GGCCGCAGCGTCCTCCTTGCAGG + Exonic
949201697 3:1387894-1387916 GGGCGTAGGACCCTCCGAGCCGG - Intronic
950424147 3:12915544-12915566 GGCCCCAGCACCACCCGGGCGGG - Intronic
950530406 3:13549492-13549514 GTCCGCAGCTTCCTCCGCTCTGG + Intronic
950940233 3:16884550-16884572 GGTCGGAGCACCCGCCACGCAGG - Intronic
951491219 3:23272166-23272188 GGCCTCAGCCACCTCCCCGCGGG - Intronic
952963381 3:38606574-38606596 GGCCCCAGCAGCCTCCCCACTGG - Intronic
955219683 3:57013085-57013107 GGCCTCAGCTGCCTCCCCGCTGG + Intronic
956479638 3:69660884-69660906 GGCCTCAGCCGCCTCCCCGCGGG + Intergenic
960669222 3:120140467-120140489 GGCCTCAGCTGCCTCCCCGCGGG + Intergenic
960934697 3:122891157-122891179 GCCTGCAGCACTCTCCACGCTGG + Intergenic
963397896 3:144757098-144757120 GGCCTCAGCCACCTCCCCGCGGG + Intergenic
963554678 3:146772563-146772585 GGCCTCAGCTGCCTCCCCGCCGG + Intergenic
964064079 3:152559653-152559675 GGCCTCAGCTGCCTCCCCGCAGG + Intergenic
964129265 3:153268899-153268921 GGCCTCAGCCGCCTCCCCGCGGG + Intergenic
965728596 3:171746101-171746123 GGCCTCAGCCGCCTCCCCGCGGG + Intronic
967594904 3:191317150-191317172 GGCCTCAGCCGCCTCCCCGCGGG - Intronic
968114978 3:196082242-196082264 GCCCGCAGCGCCCTCCGCATAGG - Intergenic
968443124 4:634452-634474 GGCACCAGCATCCTCCGCACAGG + Intronic
969912891 4:10461505-10461527 GGCTGCACCGCCCGCCGCGCGGG - Intergenic
970408631 4:15786877-15786899 GGCCTCAGCTGCCTCCCCGCGGG - Intronic
970574557 4:17414429-17414451 GGCCTCAGCCGCCTCCCCGCGGG - Intergenic
973684334 4:53354227-53354249 GGCCTCAGCCACCTCCCCGCGGG - Intronic
974807549 4:66899601-66899623 GGCCTCAGCTGCCTCCCCGCAGG - Intergenic
974838217 4:67275386-67275408 GGCTTCAGCAGCCTCCCCGCAGG - Intergenic
978748583 4:112222651-112222673 GGCCTCAGCTGCCTCCCCGCAGG + Intergenic
978929780 4:114296293-114296315 GGCCTCAGCTGCCTCCCCGCTGG - Intergenic
980562949 4:134501873-134501895 GGCCTCAGCCACCTCCCCGCAGG + Intergenic
982343585 4:154331665-154331687 GGCAGCAGCACCATCTGCCCAGG + Exonic
983369749 4:166842967-166842989 GGCCTCAGCTGCCTCCCCGCGGG - Intronic
984918122 4:184741425-184741447 GGCCTCAGCTGCCTCCCCGCAGG + Intergenic
985269322 4:188179180-188179202 GGCCTCAGCTGCCTCCCCGCAGG + Intergenic
985438903 4:189964097-189964119 GGGCGCAGGACCCTCCAAGCCGG - Intergenic
985665717 5:1180714-1180736 GGATGCAGCGCCCTCCCCGCTGG + Intergenic
985824738 5:2183830-2183852 GCCCCCAGCAGCCTCCCCGCAGG - Intergenic
986104141 5:4643747-4643769 GGCCACAGCAAGCACCGCGCTGG - Intergenic
986824414 5:11505032-11505054 GCCCGCAGCAGCCTCCAGGCAGG - Intronic
987084454 5:14456007-14456029 GGCCTCAGCCACCTCCCCGCGGG - Intronic
987696616 5:21341615-21341637 GGCCTCAGCCACCTCCCCGCGGG + Intergenic
988755587 5:34244955-34244977 GGCCTCAGCCACCTCCCCGCGGG - Intergenic
990665700 5:58069276-58069298 GGCCTCAGCTGCCTCCCCGCAGG - Intergenic
991743831 5:69710697-69710719 GGCCTCAGCCACCTCCCCGCGGG - Intergenic
991753882 5:69844545-69844567 GGCCTCAGCCACCTCCCCGCGGG + Intergenic
991795403 5:70290429-70290451 GGCCTCAGCCACCTCCCCGCGGG - Intergenic
991803507 5:70401300-70401322 GGCCTCAGCCACCTCCCCGCGGG + Intergenic
991823198 5:70585965-70585987 GGCCTCAGCCACCTCCCCGCGGG - Intergenic
991833194 5:70719658-70719680 GGCCTCAGCCACCTCCCCGCGGG + Intergenic
991887770 5:71289948-71289970 GGCCTCAGCCACCTCCCCGCGGG - Intergenic
993116225 5:83722476-83722498 GGCGGCCGCACCCCGCGCGCTGG - Intergenic
993202197 5:84830455-84830477 GGCCTCAGCTGCCTCCCCGCGGG - Intergenic
995462440 5:112418794-112418816 GGCCGCTGTCCCCTGCGCGCAGG - Intronic
996290994 5:121852110-121852132 GGCCGCAGCCGCCTCCTCCCGGG + Exonic
997375523 5:133394571-133394593 GGCCTCAGCTGCCTCCCCGCAGG + Intronic
1002524355 5:179807014-179807036 GGCCGCAGCACCGCCGTCGCCGG + Intronic
1002616468 5:180459388-180459410 GGCCTCAGCTGCCTCCCCGCGGG + Intergenic
1003139151 6:3456741-3456763 GGCCGCAGCGCCCGGGGCGCGGG - Intronic
1003178491 6:3771812-3771834 GGCCTTAGCGCCCTCCCCGCGGG + Intergenic
1005554223 6:26956728-26956750 GGCCTCAGCCACCTCCCCGCGGG - Intergenic
1006302286 6:33200084-33200106 GGCCTTAGCACCCTCCCCCCCGG - Intronic
1006337434 6:33427990-33428012 CGCCGCCGCCCCCACCGCGCCGG + Intronic
1007092415 6:39192495-39192517 GCCCCCAGCACCCTCCAAGCTGG + Intronic
1007902039 6:45422010-45422032 GGCCGCCGCTCCCCCCGCGCGGG - Intronic
1013619427 6:111873346-111873368 CGCGGCAGCCCCCTCCTCGCCGG + Exonic
1016272220 6:142302077-142302099 GGCGGCAGGTCCCTCCTCGCAGG - Exonic
1018109385 6:160520407-160520429 GGCCTCAGCCGCCTCCCCGCAGG - Intergenic
1018873059 6:167797438-167797460 GGCGGCAGCATCCTCCGCCTTGG - Intergenic
1019712476 7:2523962-2523984 GGTGGCTGCACCCTACGCGCGGG + Intronic
1020210558 7:6154891-6154913 CGCCCCAGCAGCCCCCGCGCAGG + Exonic
1020418283 7:7969689-7969711 GGCCGCAGCCCCGGCCGAGCAGG + Exonic
1020784416 7:12556300-12556322 GGCCTCAGCTTCCTCCCCGCGGG - Intergenic
1022018696 7:26377205-26377227 GGCGGCTGCAGCCTCCGCACTGG - Intergenic
1024947288 7:54821797-54821819 GGCTGCAGCCGCCTCCTCGCAGG + Intergenic
1029124025 7:98285233-98285255 GGCCGTGGCAGCCTCCACGCTGG - Intronic
1031585449 7:123527974-123527996 GGGCGTAGGACCCTCCGAGCCGG + Intronic
1032339666 7:131058982-131059004 GGCCTCAGCTGCCTCCCCGCGGG + Intergenic
1034179492 7:149126433-149126455 GGCCCGGGCACCCTCCGTGCGGG + Intronic
1034339185 7:150341197-150341219 GCCCGCGGCAGCCCCCGCGCCGG - Exonic
1034491617 7:151396016-151396038 GGCCGCGGCCTCCTCCGCGCAGG + Exonic
1035265588 7:157688965-157688987 GGCCGCAGCACCCTCCGCGCCGG - Intronic
1035463882 7:159063280-159063302 GGCCTCAGCTGCCTCCCCGCAGG - Intronic
1036135075 8:6152926-6152948 GGCCTCAGCTGCCTCCCCGCAGG + Intergenic
1039595520 8:38787341-38787363 GGCCGCAGCGGGCCCCGCGCCGG - Exonic
1040794191 8:51271458-51271480 GGCCTCAGCTGCCTCCCCGCAGG + Intergenic
1041068548 8:54104412-54104434 GGCCTCAGCCGCCTCCCCGCGGG + Intergenic
1041109372 8:54470410-54470432 GCCCGCAGCCCCCTCATCGCTGG + Intergenic
1042948743 8:74179671-74179693 GGCCTCAGCTGCCTCCCCGCAGG - Intergenic
1044459635 8:92429373-92429395 GGCCTCAGCTGCCTCCCCGCAGG - Intergenic
1046260304 8:111758897-111758919 GGCCTCAGCCACCTCCCCGCGGG - Intergenic
1046322225 8:112594350-112594372 GGGCGTAGGACCCTCCGAGCCGG - Intronic
1046932559 8:119855931-119855953 GCCCGCAGCGCGCTCCGCCCCGG - Exonic
1048112869 8:131487248-131487270 GGCCTCAGCTGCCTCCCCGCAGG + Intergenic
1049457565 8:142701149-142701171 GGCCGCAGCACCCTGACCCCAGG - Intronic
1049557342 8:143289569-143289591 GTCCGCAGCCTCCTCCGCCCGGG - Intergenic
1049562492 8:143318654-143318676 GGCCACAGCAACCTCCGCCCTGG - Intronic
1049762694 8:144338201-144338223 CTCCGCCGCACCCCCCGCGCGGG - Intergenic
1051929039 9:22363614-22363636 GGCCTCAGCCGCCTCCCCGCGGG - Intergenic
1052478296 9:28990211-28990233 GGGCGTAGGACCCTCCGAGCCGG - Intergenic
1053312363 9:37027716-37027738 GGGCTCAGCTCCCTCCGGGCGGG + Intronic
1055925639 9:81507591-81507613 GGCCTCAGCCACCTCCCCGCGGG + Intergenic
1056434265 9:86560015-86560037 GACCGCAGCAGCTTCCCCGCCGG - Intergenic
1056677231 9:88686057-88686079 GGCCGCAGCTGCCTCCCCGCGGG - Intergenic
1060187952 9:121575296-121575318 GACAGCAGCAGCCACCGCGCAGG + Intronic
1061288090 9:129635635-129635657 TTCAGCAGCACCCTCCCCGCCGG - Exonic
1062059473 9:134487277-134487299 GACCTCAGCACCCTCCCAGCTGG + Intergenic
1062286079 9:135773127-135773149 GGCCACATCACCCTCGTCGCCGG + Intronic
1062537649 9:137027925-137027947 GGCCCGAGCCCCCTCCCCGCCGG - Intronic
1185892792 X:3835584-3835606 GGCCGCCGCATCCGCCGCGGCGG + Intronic
1185897900 X:3874004-3874026 GGCCGCCGCATCCGCCGCGGCGG + Intergenic
1185903019 X:3912435-3912457 GGCCGCCGCATCCGCCGCGGCGG + Intergenic
1187698062 X:21940724-21940746 GGGCGCAGCACACTCCCAGCCGG + Exonic
1188895964 X:35668662-35668684 GGCTGCAGCACTCTCGGCGGCGG + Intergenic