ID: 1035267957

View in Genome Browser
Species Human (GRCh38)
Location 7:157702511-157702533
Sequence CTGAGCCAGCCAGTGAGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035267957_1035267959 -10 Left 1035267957 7:157702511-157702533 CCCACGCTCACTGGCTGGCTCAG 0: 1
1: 0
2: 0
3: 11
4: 154
Right 1035267959 7:157702524-157702546 GCTGGCTCAGTGCCCTCCATAGG 0: 1
1: 0
2: 1
3: 20
4: 203
1035267957_1035267964 8 Left 1035267957 7:157702511-157702533 CCCACGCTCACTGGCTGGCTCAG 0: 1
1: 0
2: 0
3: 11
4: 154
Right 1035267964 7:157702542-157702564 ATAGGCTCCTGTCCACCGGCAGG 0: 1
1: 0
2: 0
3: 2
4: 62
1035267957_1035267962 4 Left 1035267957 7:157702511-157702533 CCCACGCTCACTGGCTGGCTCAG 0: 1
1: 0
2: 0
3: 11
4: 154
Right 1035267962 7:157702538-157702560 CTCCATAGGCTCCTGTCCACCGG No data
1035267957_1035267966 18 Left 1035267957 7:157702511-157702533 CCCACGCTCACTGGCTGGCTCAG 0: 1
1: 0
2: 0
3: 11
4: 154
Right 1035267966 7:157702552-157702574 GTCCACCGGCAGGCGTGCTGCGG No data
1035267957_1035267969 24 Left 1035267957 7:157702511-157702533 CCCACGCTCACTGGCTGGCTCAG 0: 1
1: 0
2: 0
3: 11
4: 154
Right 1035267969 7:157702558-157702580 CGGCAGGCGTGCTGCGGCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035267957 Original CRISPR CTGAGCCAGCCAGTGAGCGT GGG (reversed) Intronic
900131595 1:1089555-1089577 CTGTGGCAGCCAGTGAGGCTGGG - Intronic
900798734 1:4725003-4725025 CAGAGCCAGACAGTGTGCGCTGG - Intronic
902158946 1:14513387-14513409 CCCAGCCACCCAGTGAGCCTGGG - Intergenic
902620672 1:17648981-17649003 CTGTGCCAGCCACTGTGGGTTGG + Intronic
902890355 1:19438826-19438848 CTGAGCCACCCAGTGCCCGCCGG - Intronic
903684118 1:25118801-25118823 TTGGGCCAGCCAGTGAGGGGTGG + Intergenic
905966688 1:42104433-42104455 ATTAGCCAGCCAGTGGGCGAGGG - Intergenic
906518857 1:46455721-46455743 CCCAGCCACCCAGTGAACGTTGG - Intergenic
907731397 1:57069995-57070017 CTGTGCAAGCCAGTGAGCAAGGG + Intronic
912581784 1:110727542-110727564 CTGAGCCAGCCAGGGAGACAGGG + Intergenic
913079217 1:115366196-115366218 GTGAGACAGCAAGTGAACGTGGG + Intergenic
916223128 1:162464304-162464326 CTGAGGCAGCCAGATAGCTTGGG - Intergenic
919666215 1:200295273-200295295 CTCACCCAGGCAGTGAGCATAGG - Intergenic
919763503 1:201112461-201112483 CTGAGCCAGCCAGGGGGCGGGGG + Exonic
1062857802 10:788117-788139 CTGGGCCAGCCACTGGGCGCTGG + Intergenic
1063870979 10:10417461-10417483 CTGAGCCAGCCACTGGGCCCTGG - Intergenic
1065350028 10:24787067-24787089 CCGAGCCAGCCAGTGGTCCTGGG + Intergenic
1067681163 10:48442175-48442197 GTGAGGCAGCCAGTGAGGGCAGG - Intergenic
1068367293 10:56067999-56068021 GTGAGCTTGCCAGTGAGTGTTGG + Intergenic
1069530970 10:69219200-69219222 ATTAGCCAGCCAGTGACTGTGGG + Intergenic
1070331843 10:75423101-75423123 CTGAGGCAGCAAGTGCACGTCGG - Intergenic
1071181075 10:82984469-82984491 CTGAGCCAGCCGGTGGGAATGGG - Intronic
1071563910 10:86661962-86661984 TTGAGCCAGCCACTGAGGGCTGG + Intronic
1074833206 10:117264110-117264132 CTTGGCCAGCCAGTGAGAGAGGG - Intronic
1076637188 10:131889801-131889823 CTGGGCCCGGCAGTGAGCGCGGG - Intergenic
1076991562 11:278710-278732 CTGAGCCTGGGAGTGAGGGTGGG - Intronic
1078315966 11:10293838-10293860 CTGAGCCTGGCGGTGGGCGTGGG - Intronic
1081534575 11:43987624-43987646 CAGAGCCAGCCAGGGAGTGGGGG - Intergenic
1083375149 11:62214339-62214361 CAGAGCCAGCCAGGGAGGGGAGG + Intergenic
1084608940 11:70188577-70188599 CTGAGCCACACAGGGGGCGTGGG + Exonic
1087648626 11:100838031-100838053 CTGAGGCAGGCAGTTAGCGAGGG - Intronic
1089541142 11:119189604-119189626 CTGGGCCAGCCTGTGATCGGTGG - Exonic
1091684163 12:2549900-2549922 CAGAGCCAGGCATTGAGGGTGGG - Intronic
1094359138 12:29610859-29610881 CTGAGCCAACTAGAGAGTGTGGG - Intronic
1096234120 12:49914198-49914220 CTCAGCCTGCCAGTGAGGTTAGG + Intergenic
1099019089 12:77381163-77381185 CTGAGTCACCCAGTGAGACTCGG + Intergenic
1102549192 12:113678777-113678799 CCGTGCCAGCCAGTGAGTGATGG + Intergenic
1102782042 12:115573645-115573667 CTGAGCCAGCCAGGGTGCCCAGG + Intergenic
1103718857 12:122962629-122962651 TTGAGGCAGTCAGTGAGTGTAGG + Intronic
1103948370 12:124539367-124539389 CGGAGCCGGCCAGTGGGCCTGGG - Intronic
1104000587 12:124857459-124857481 CAGAGCCACACAGTGAGCCTTGG - Intronic
1104035626 12:125095398-125095420 CTGAGCCTGCCAGTGATCTGGGG - Intronic
1104109223 12:125689701-125689723 CTGAGGCAGTCAGGGAGCTTTGG - Intergenic
1105937934 13:25119102-25119124 CTGAGCGAGCTCGTGGGCGTCGG - Intergenic
1106837256 13:33648284-33648306 CTCATCCAGCTAGTGAGCCTCGG - Intergenic
1107281049 13:38735752-38735774 CTGCTCCAGGCAGTGAGCATGGG + Intronic
1109999021 13:70169794-70169816 ATTAGCCAGCCAGTGACTGTAGG - Intergenic
1113769731 13:112900350-112900372 CAGTGCCAGCCACTGAGGGTGGG + Intronic
1119421702 14:74511200-74511222 CTGAGCCAGCCATTCGGCCTTGG - Intronic
1121767869 14:96502801-96502823 CTGACCCAGCCAGGAAGGGTCGG - Intronic
1121863830 14:97343859-97343881 CAGAGCCAGCAACTGAGGGTGGG - Intergenic
1125021884 15:34994110-34994132 CTGAGCCAACCAAGGAGGGTGGG + Intergenic
1125687779 15:41573612-41573634 CTGAGCCAGGCAGAGAGCCATGG - Intronic
1127395597 15:58541842-58541864 CCGGCCCAGCCAGTGAACGTGGG + Exonic
1128795528 15:70463670-70463692 TAGAGCCAGCCAATGAGCCTAGG - Intergenic
1130792369 15:87169131-87169153 CTGAGCAAGCCAGTGAGAATGGG - Intergenic
1135517738 16:23149404-23149426 CCGAGCCAGCGAGCGAGCGGCGG + Intergenic
1137062225 16:35801361-35801383 ATGAGCCAGGCAGTGAGCTGTGG - Intergenic
1138269021 16:55681368-55681390 CTGAGCCAGGCAGTGTGCCGGGG - Intronic
1142054291 16:87983024-87983046 CTGAGGCAGCCACTGAGAGCGGG - Intronic
1142229446 16:88892959-88892981 CTGAGCCAGCCTGGTAGGGTTGG - Intronic
1142996735 17:3764891-3764913 CTGAGACAGACAGTGAGCTCCGG + Intronic
1144738370 17:17567483-17567505 CAGAGCCAGGCAGTGGACGTGGG - Intronic
1145937857 17:28725803-28725825 CTCAGCCCGCCAGTGAGCGATGG + Intronic
1147855998 17:43480522-43480544 CTGACCCAACCAGAGAGCCTGGG - Intergenic
1156022239 18:32612939-32612961 CTGTGCCAGGCATTGAGCTTAGG - Intergenic
1156128974 18:33944908-33944930 TTGAGCCAGGCAGTGATCATCGG - Intronic
1158254594 18:55531690-55531712 CTGAGCCATCCAGTGAGGACTGG - Intronic
1158556307 18:58477509-58477531 CTGTCCCAGCCAGAGAGCATAGG - Intergenic
1160387130 18:78503518-78503540 CTGAGCCAGCCTGTGTTCGCTGG - Intergenic
1161066422 19:2240617-2240639 CTGAGCCAGCCACTGGCCGCTGG + Intronic
1161303156 19:3552823-3552845 CTGACACAGCCTGTAAGCGTGGG + Intronic
1161842793 19:6693138-6693160 GTCAACCAGCCAATGAGCGTGGG + Intronic
1162780188 19:13002692-13002714 CTGCGCCAGCCAGGGAGGGGAGG + Intronic
1165345625 19:35247691-35247713 CTGAGTAAGCCAGAGAGAGTGGG + Intergenic
1165890717 19:39110583-39110605 CTGAGCCCGGCACTGAGAGTTGG + Exonic
1167720180 19:51174011-51174033 CTGAGCCAGCGAGGCAGGGTGGG + Intergenic
926908305 2:17826355-17826377 CTGAGTTAGCCAGTGAGCGAGGG - Intergenic
937004313 2:118497299-118497321 CTGAGCTAGGCAGGGAGTGTGGG - Intergenic
940347045 2:152638757-152638779 CACAGCCAGCCAGTGGGCTTGGG - Intronic
941452716 2:165678851-165678873 CTGTGGCAGCCATTCAGCGTGGG - Exonic
945054718 2:205858643-205858665 CTGAGTCTGCCAGTGAGCCCAGG + Intergenic
945296050 2:208172448-208172470 CTGTGCCAGCAAGGGAGAGTGGG - Intronic
946032105 2:216713588-216713610 CTGAGCCAGCCAGATATTGTGGG - Intergenic
948719972 2:239893327-239893349 CTGAGCCAATCAGAGAGCCTGGG + Intronic
1169275365 20:4230153-4230175 CTGAGCCAGACAGGGAGCACAGG - Intronic
1170886093 20:20340845-20340867 CTGATCCAGCGAGTGGGCGTGGG + Intronic
1171055777 20:21904733-21904755 CTGAGCAGGCCAGTGAGGGGTGG + Intergenic
1171483090 20:25468505-25468527 CAGTGCCAACCAGTGAGAGTCGG - Intronic
1172125936 20:32625359-32625381 CTGAGCCAGCCAGGGAGGGCTGG + Intergenic
1173689352 20:44948041-44948063 CTCAGCCAGCCAGTAAATGTTGG - Intronic
1173844082 20:46177142-46177164 CAGTGCCAGCCAGTGAGGGCGGG + Intronic
1174090675 20:48044520-48044542 CTCTGCCAGAGAGTGAGCGTGGG - Intergenic
1174239842 20:49124640-49124662 GTGTGCCAGCCAGTGTGCCTTGG - Intronic
1174618572 20:51856010-51856032 ATGAGGCAGCCAGTGGGGGTGGG + Intergenic
1179172728 21:38985271-38985293 CTGGCCCAGCCAGGGACCGTGGG - Intergenic
1179479585 21:41668938-41668960 CTGAGCCAGCCAAGGAGGGCCGG + Intergenic
1179531842 21:42024807-42024829 CTGGGTCAGCCTGTGGGCGTGGG - Intergenic
1179896266 21:44365425-44365447 CTGTGCCAGCCAGGAAGCCTGGG - Intronic
1182078328 22:27510608-27510630 CTGGGGCAGCCAGTGAGAGGTGG - Intergenic
1184721819 22:46319125-46319147 CTCAGCCAGTCAGTGACCGAGGG + Intronic
1185129765 22:49032324-49032346 CTGAGCCAGGGAGGGTGCGTAGG + Intergenic
1185369911 22:50456230-50456252 CTGAGTCCTCCAGTGAGCGCAGG + Exonic
952990766 3:38829089-38829111 CTGAGCCACCCACTGATCTTTGG - Intergenic
954380411 3:50216095-50216117 CGGACCCAGCCTGTGAGCGTGGG + Intronic
956420490 3:69081685-69081707 CAATGCCAGGCAGTGAGCGTGGG + Intergenic
960502468 3:118454533-118454555 CTGGTCCAGCCTGTGAGCCTTGG - Intergenic
960533347 3:118789610-118789632 CTGTGCCAGCCAGTGTGAATAGG + Intergenic
961559935 3:127721751-127721773 CAGAGCCAGGCAGTGACCATGGG + Intronic
962275295 3:134008728-134008750 CTGAGCCAGCCCCTGGGAGTGGG + Intronic
962827720 3:139112091-139112113 CTGAGCTGGACAGAGAGCGTGGG + Intronic
962944706 3:140156605-140156627 CTGAGCCAGTGACTGAGTGTGGG + Intronic
968591715 4:1462925-1462947 GTGAGCCAGCCAGGGAGCCAAGG + Intergenic
968919387 4:3514828-3514850 CTGAGGCACGCAGAGAGCGTGGG - Exonic
968985787 4:3873647-3873669 CTGAGCCAGCCAGGCAGGGGCGG + Intergenic
969314100 4:6371230-6371252 CTGAGCCAGCCAGAGGGTGCGGG - Intronic
970482303 4:16488480-16488502 CTTAGCCAGCCAGTCAGAGGTGG - Intergenic
971918744 4:32909750-32909772 CTCAGCCAGACAGTGAGAGCAGG + Intergenic
980755061 4:137147802-137147824 CTGAAACAGCCAGAGAGTGTGGG + Intergenic
984935959 4:184889646-184889668 GTGTGCCAGCCAGGGAGTGTGGG + Intergenic
986054740 5:4125355-4125377 TTGAGCCATTTAGTGAGCGTGGG - Intergenic
988458846 5:31413973-31413995 CTGAGTCAGCCAGTGAGAGAAGG + Intronic
992633290 5:78702255-78702277 CTGAGCCAGCCAGGAAGCCAGGG + Intronic
993867543 5:93213264-93213286 CAGTGCCAGACAGTGAGCGCAGG + Intergenic
993871629 5:93261156-93261178 CAGTGCCAGACAGTGAGCGCAGG + Intergenic
996916076 5:128713674-128713696 CTGAGGCAGGCAGGGAGGGTGGG + Intronic
1001573189 5:172744270-172744292 CTGAGCCACCCAGGGAGGGTGGG + Intergenic
1003557833 6:7156793-7156815 CTTAGCCAGCCATCCAGCGTAGG + Intronic
1008535957 6:52506250-52506272 CAGAGCCAGCCAGGGAAAGTGGG - Intronic
1013112067 6:107072106-107072128 ATGAGCTAGTCAGTGAGCGCTGG + Intronic
1015562452 6:134531034-134531056 CAGAGCTGGCCAGTTAGCGTTGG + Intergenic
1018182035 6:161232614-161232636 CTGAGCCAGCCACGGAGCCCTGG + Intronic
1020072003 7:5233282-5233304 CTGAGGCCGCCAGTGAGGCTGGG - Exonic
1022121667 7:27314511-27314533 ATCAGCCAGCCTGTGAGTGTAGG + Intergenic
1022518248 7:30989042-30989064 TTGAGCCAGCCAGTGTGCCAAGG - Intronic
1022518442 7:30990030-30990052 TTGAGCCAGCCAGTGAGCCAAGG - Intronic
1024150594 7:46568071-46568093 CTGAGCCAGCCAGTCAACAATGG + Intergenic
1026911472 7:74093993-74094015 CTGAGCCACCAAGTCAGCCTGGG + Intronic
1032989301 7:137373828-137373850 CTCAGCCAGCTAGTGATCGGGGG - Intergenic
1034441036 7:151086309-151086331 CAGAGCCAGCGAGCGAGCGAGGG + Intronic
1034787096 7:153935706-153935728 CTGAGCCAGGCTGTGAGCCCAGG - Intronic
1035043503 7:155948404-155948426 CTGAGCCAGCAAGGGACCATGGG + Intergenic
1035267957 7:157702511-157702533 CTGAGCCAGCCAGTGAGCGTGGG - Intronic
1035282519 7:157786972-157786994 CTGAGGAAGCCACTGAGCCTGGG + Intronic
1037946995 8:22995956-22995978 CTGAGCCAGGCGGTCTGCGTTGG + Intronic
1039705253 8:39999877-39999899 CAGAGGCAGCCAGTGACCATGGG + Intronic
1047442235 8:124888428-124888450 CTGAGTCATCTTGTGAGCGTGGG + Intergenic
1049408013 8:142460287-142460309 CTGAGCCTGCCAGTGGGCACGGG - Intronic
1049449815 8:142654617-142654639 CTGAGCCAGCCAGGGAGGTCAGG - Intergenic
1051585080 9:18718811-18718833 CTGAGGCAGGAAGTGACCGTGGG - Intronic
1052970085 9:34372087-34372109 CTGAGCTACCGAGTGTGCGTGGG - Exonic
1055397552 9:75891139-75891161 CGGAACCAGCCAGCGAGCGAGGG + Exonic
1056245513 9:84691279-84691301 CTGAGAAAGCCAGTGAAAGTTGG + Intronic
1057723156 9:97548898-97548920 CTGAGCCTGCCAGTCAGAGCTGG - Intronic
1057821105 9:98331741-98331763 ATGTGCGAGCCAGTGAGTGTGGG + Intronic
1060258703 9:122055076-122055098 CTGAGCCAGGCAGTATGCTTGGG + Intronic
1060516908 9:124271679-124271701 CTCAGCCAGCCAGTGTGCCTGGG - Intronic
1061262438 9:129487680-129487702 CTGGTCCAGCCAGTGAGGGGTGG - Intergenic
1061558234 9:131385402-131385424 CTGAGGCTGCCAGTGAGGGCTGG - Intergenic
1062380720 9:136285401-136285423 GAGAGGCAGCCCGTGAGCGTGGG + Intronic
1062503383 9:136860829-136860851 CTTTACCAGCCAGTGAGGGTGGG + Intronic
1186274149 X:7921800-7921822 CTGGGCCAGCTCGTGAGCGCTGG + Exonic
1186792104 X:13009471-13009493 CTGGGCCAGCCAGTGACAGCTGG - Intergenic
1190534014 X:51408090-51408112 CTGACCCAGACAGAGAGCGGCGG - Exonic
1197759789 X:130019994-130020016 ATGTGCCAGGCAGTGGGCGTGGG + Intronic
1200038205 X:153346713-153346735 CTGAGACAGCCACTGAGCACGGG - Intronic