ID: 1035268445

View in Genome Browser
Species Human (GRCh38)
Location 7:157705467-157705489
Sequence CTCAGTTCCTGGCATTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035268445_1035268453 12 Left 1035268445 7:157705467-157705489 CCCCCAGAATGCCAGGAACTGAG No data
Right 1035268453 7:157705502-157705524 CAGTGCCTTCCAGATCAACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035268445 Original CRISPR CTCAGTTCCTGGCATTCTGG GGG (reversed) Intronic