ID: 1035268556

View in Genome Browser
Species Human (GRCh38)
Location 7:157706054-157706076
Sequence CTCAGTTCCCGGCATTCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 2, 1: 1, 2: 4, 3: 15, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035268556_1035268562 2 Left 1035268556 7:157706054-157706076 CCCCTAGAATGCCGGGAACTGAG 0: 2
1: 1
2: 4
3: 15
4: 76
Right 1035268562 7:157706079-157706101 AATCTGTCCCAGGTGCCTTCCGG No data
1035268556_1035268560 -8 Left 1035268556 7:157706054-157706076 CCCCTAGAATGCCGGGAACTGAG 0: 2
1: 1
2: 4
3: 15
4: 76
Right 1035268560 7:157706069-157706091 GAACTGAGCCAATCTGTCCCAGG 0: 1
1: 0
2: 2
3: 17
4: 104
1035268556_1035268565 12 Left 1035268556 7:157706054-157706076 CCCCTAGAATGCCGGGAACTGAG 0: 2
1: 1
2: 4
3: 15
4: 76
Right 1035268565 7:157706089-157706111 AGGTGCCTTCCGGATTAACGTGG 0: 1
1: 1
2: 4
3: 7
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035268556 Original CRISPR CTCAGTTCCCGGCATTCTAG GGG (reversed) Intronic