ID: 1035268640

View in Genome Browser
Species Human (GRCh38)
Location 7:157706510-157706532
Sequence CTCAGTTCCCGGCATTCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035268640_1035268646 12 Left 1035268640 7:157706510-157706532 CCTCTAGAATGCCGGGAACTGAG No data
Right 1035268646 7:157706545-157706567 AGGTGCCTTCTGGATAAACGTGG No data
1035268640_1035268643 2 Left 1035268640 7:157706510-157706532 CCTCTAGAATGCCGGGAACTGAG No data
Right 1035268643 7:157706535-157706557 AATCTGACCCAGGTGCCTTCTGG 0: 8
1: 2
2: 1
3: 12
4: 124
1035268640_1035268642 -8 Left 1035268640 7:157706510-157706532 CCTCTAGAATGCCGGGAACTGAG No data
Right 1035268642 7:157706525-157706547 GAACTGAGCGAATCTGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035268640 Original CRISPR CTCAGTTCCCGGCATTCTAG AGG (reversed) Intronic