ID: 1035268710

View in Genome Browser
Species Human (GRCh38)
Location 7:157706903-157706925
Sequence CTCAGTTCCCGGCATTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035268710_1035268716 9 Left 1035268710 7:157706903-157706925 CCTCCAGAATGCCGGGAACTGAG No data
Right 1035268716 7:157706935-157706957 CCCAGGTGCCTTCTGGATCAAGG No data
1035268710_1035268714 2 Left 1035268710 7:157706903-157706925 CCTCCAGAATGCCGGGAACTGAG No data
Right 1035268714 7:157706928-157706950 AATCTGACCCAGGTGCCTTCTGG No data
1035268710_1035268713 -8 Left 1035268710 7:157706903-157706925 CCTCCAGAATGCCGGGAACTGAG No data
Right 1035268713 7:157706918-157706940 GAACTGAGCAAATCTGACCCAGG No data
1035268710_1035268718 12 Left 1035268710 7:157706903-157706925 CCTCCAGAATGCCGGGAACTGAG No data
Right 1035268718 7:157706938-157706960 AGGTGCCTTCTGGATCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035268710 Original CRISPR CTCAGTTCCCGGCATTCTGG AGG (reversed) Intronic