ID: 1035270045

View in Genome Browser
Species Human (GRCh38)
Location 7:157714380-157714402
Sequence CGCAAGCCCAGCCCTGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 237}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035270045_1035270052 18 Left 1035270045 7:157714380-157714402 CCCTGTGCAGGGCTGGGCTTGCG 0: 1
1: 0
2: 2
3: 15
4: 237
Right 1035270052 7:157714421-157714443 AGCTCTGCTTGGCAGAATTGAGG No data
1035270045_1035270053 19 Left 1035270045 7:157714380-157714402 CCCTGTGCAGGGCTGGGCTTGCG 0: 1
1: 0
2: 2
3: 15
4: 237
Right 1035270053 7:157714422-157714444 GCTCTGCTTGGCAGAATTGAGGG 0: 1
1: 0
2: 0
3: 12
4: 145
1035270045_1035270049 7 Left 1035270045 7:157714380-157714402 CCCTGTGCAGGGCTGGGCTTGCG 0: 1
1: 0
2: 2
3: 15
4: 237
Right 1035270049 7:157714410-157714432 TCTTTCCCGGCAGCTCTGCTTGG No data
1035270045_1035270047 -6 Left 1035270045 7:157714380-157714402 CCCTGTGCAGGGCTGGGCTTGCG 0: 1
1: 0
2: 2
3: 15
4: 237
Right 1035270047 7:157714397-157714419 CTTGCGACCTCAGTCTTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035270045 Original CRISPR CGCAAGCCCAGCCCTGCACA GGG (reversed) Intronic
900577695 1:3391830-3391852 CCCAAGCACAGGCGTGCACAGGG + Intronic
901005828 1:6171095-6171117 AGGAAACCCAGCCCAGCACATGG + Intronic
904039282 1:27575125-27575147 CGCAGGCCCAGCACTTCTCAGGG + Intronic
904436331 1:30500103-30500125 CATTAGCCCAGGCCTGCACAGGG + Intergenic
905170699 1:36108000-36108022 TGCCAGCCAAGCCCTGTACAGGG - Intronic
905889110 1:41508676-41508698 GGCAAGTACAGCCCCGCACAGGG + Exonic
906459597 1:46027276-46027298 CCCAAGACCAGCCATGGACATGG + Intronic
908027416 1:59967602-59967624 AGAAAGCCCAGCCTTGCTCAGGG - Intergenic
909663762 1:78111368-78111390 TGTAAGCCCAGCCCCTCACAGGG - Intronic
912746782 1:112251948-112251970 CTCCACCCTAGCCCTGCACAGGG + Intergenic
915042972 1:152983826-152983848 CTCAAGGCAAGCCCTGCACCTGG + Intergenic
916714212 1:167435672-167435694 CCCAAGCCCAGCATTGCCCAGGG + Intronic
918134182 1:181656342-181656364 CACTAGCCTAGGCCTGCACAGGG - Intronic
920641166 1:207752792-207752814 TGCTCGCCCAGCCCAGCACATGG - Intronic
922935601 1:229419957-229419979 CCCAGTCCCAGCCCTGCACTGGG - Intergenic
1062934286 10:1374623-1374645 AGCAAGCGCAGCGCTGCATACGG - Intronic
1062992400 10:1832687-1832709 GGCCAGCCAAGCCCTGCAGAGGG - Intergenic
1063382514 10:5594783-5594805 CCTGAGCCCAGCCCTGCTCAGGG - Intergenic
1064408451 10:15085044-15085066 AGCAAGCCCAGCTCTGCAACAGG - Intronic
1066049617 10:31621582-31621604 CCCCAGCCCAGCCCTGCACAAGG + Intergenic
1066656921 10:37705078-37705100 AGCCAGCCAAGCCCTACACAAGG - Intergenic
1067812619 10:49441740-49441762 CGCCAGCCCCGCTGTGCACAGGG + Intergenic
1069870214 10:71528476-71528498 TGCAAGGCCAGCCGTGCAGAAGG - Intronic
1070143876 10:73759773-73759795 CCAAAGCCCAGCCCTGAAGAAGG - Exonic
1070411993 10:76150273-76150295 CGCATGCCCAGCCTTTGACAAGG - Intronic
1071299185 10:84243813-84243835 CATAAGCTCAGCCCTGCAGAGGG + Intergenic
1071504269 10:86223238-86223260 CTCCAGCCCTGCCCTGCGCATGG + Intronic
1073068613 10:100779419-100779441 TTCCAGCCCAGCCCTGCAAAGGG - Intronic
1074510116 10:114104016-114104038 CAGAACCCCAGCCCTGAACATGG - Intergenic
1074831735 10:117254395-117254417 AGCATGCCCATCCCTACACAGGG - Exonic
1074870289 10:117570678-117570700 CGGAATCCCAGCCCTGCCCGTGG - Intergenic
1075407723 10:122205673-122205695 CCCCACCCCAGCCCTGCAGAAGG + Intronic
1075651325 10:124129692-124129714 GGAAAGGCCAGGCCTGCACAGGG + Intergenic
1076358706 10:129871178-129871200 CGCGAGCCCTGCCCAGCACCCGG - Intronic
1076380358 10:130021080-130021102 CACTTGCCCAGCCCTGCACAGGG + Intergenic
1077366959 11:2165140-2165162 CACAGGTCCAGCCCTGCTCAAGG + Intronic
1078007236 11:7541096-7541118 TGCAAACACAGCCCTGCACCAGG - Intronic
1078142487 11:8702340-8702362 CTCAGGCCAAGCCCTCCACAGGG + Intronic
1079413965 11:20215599-20215621 CCCACGCCCAGGCCAGCACATGG - Intergenic
1080339727 11:31247522-31247544 TACAAGGCCAGCCCTGAACATGG - Intronic
1081858127 11:46316686-46316708 CCCAAGCCCTTCCCTGCACAAGG - Intronic
1084514617 11:69629795-69629817 AGGAAGTTCAGCCCTGCACAGGG + Intergenic
1084547320 11:69820904-69820926 TCCCAGCCCAGGCCTGCACAGGG - Intergenic
1085023129 11:73221537-73221559 CGCCTGCCCAGACCTGCCCACGG + Intronic
1085178361 11:74510759-74510781 CCCAAGCCCAGCTCAGCACTAGG - Intronic
1085532254 11:77198779-77198801 CCCAAGCCCATCCCTCCACTAGG - Intronic
1087158406 11:94926350-94926372 TGCAAGCCCAGCTCTGCATGTGG - Intergenic
1089634023 11:119800892-119800914 TTCCAGCCCAGCCCTGCACGAGG - Intergenic
1090883191 11:130852760-130852782 CGCAGGCCCAGCGCTGGACCAGG - Intergenic
1091281580 11:134384567-134384589 TGCTAGCCCAGCCCTGCACAGGG - Intronic
1091395513 12:152092-152114 CCCGAGCACAGCCTTGCACACGG + Intronic
1091776392 12:3187695-3187717 CGCAAGCCAAGACCTGTTCATGG - Intronic
1094419713 12:30257739-30257761 TGCAAGCCCAGCACAGCACTAGG - Intergenic
1095377162 12:41543893-41543915 CACAAGCCCAGCCCTGGAGCTGG + Intronic
1096223051 12:49844225-49844247 CCCAACCCCACCCCTGCACCTGG + Intergenic
1098885204 12:75953873-75953895 CACATTCCCAACCCTGCACAAGG + Intergenic
1100589760 12:96015859-96015881 GGGAAGCCCAGCCCAGCAGATGG + Intronic
1101324903 12:103706823-103706845 CCCAATGCCAGCCCTGCCCAGGG + Exonic
1102006984 12:109595415-109595437 CCACAGCCCAGCCCTGCACCAGG - Intronic
1103870575 12:124088370-124088392 CGGGAGCCCAGGCCTGCACCTGG + Exonic
1103903896 12:124317656-124317678 GGGAAGCCCAGCCAGGCACAAGG + Intergenic
1104542163 12:129675839-129675861 TGCAAGTCCATCCCAGCACAGGG - Intronic
1107564480 13:41587785-41587807 CATAGGCTCAGCCCTGCACAAGG + Intronic
1108643951 13:52408205-52408227 CCCGAGCCCTGCCCTGCTCAGGG + Intergenic
1111824567 13:93251239-93251261 AGCAAACCCATCCCTGCCCAAGG - Intronic
1112288897 13:98127544-98127566 CATTAGCCCAGACCTGCACAGGG - Intergenic
1113894496 13:113755086-113755108 GCCAAGCCCAGCCCTGCTCTGGG + Intergenic
1115727516 14:36233400-36233422 CATAAGCCCTGCCCTGCACAGGG + Intergenic
1115918282 14:38342302-38342324 TGTAAGCCCAGCCCAGCACTAGG - Intergenic
1116186783 14:41608179-41608201 CGCACACCCAGCACTGCACGGGG - Exonic
1118309562 14:64682413-64682435 GGCCAGCCCTGCCCTGCCCACGG - Intergenic
1119680863 14:76591410-76591432 CCCAAGCCGAGCCCTGGAGAGGG + Intergenic
1120275640 14:82369865-82369887 TGTAAGCCCAGCCCAGCACTAGG - Intergenic
1122154492 14:99742132-99742154 GGCAGGCCCAGCCCTTCACAGGG - Intronic
1122375381 14:101253553-101253575 TGCAAGCCAGGCCCTGGACATGG + Intergenic
1122829510 14:104388924-104388946 CGCCAGCCCCTCCCAGCACATGG - Intergenic
1125677739 15:41511697-41511719 GGCCAGCCCAGCCCAGCGCAGGG + Intronic
1125722762 15:41853048-41853070 CTCCAGCCCTGCCCTGCCCATGG - Intronic
1126697960 15:51341652-51341674 GCCAAGCCCTGCCCTGCCCAAGG + Exonic
1127766919 15:62195396-62195418 AGCCAGCCCAGCCCTGCCCCGGG + Intergenic
1129090409 15:73143629-73143651 CGCACGCCCCGTCCTGCACTAGG + Intronic
1129232492 15:74204472-74204494 AGCAAGCCCTTCCCTGCTCAGGG + Intronic
1129340407 15:74882208-74882230 AGCAAGCCCAGGCCTGAGCAAGG - Intergenic
1129700594 15:77765869-77765891 GACAGGCCCACCCCTGCACAAGG + Intronic
1129866914 15:78915835-78915857 CACATGCCCAGCCCTGCCCTAGG - Intergenic
1132825687 16:1904134-1904156 GGCAGGACCAGCCCTGCTCAGGG + Intergenic
1132971990 16:2693636-2693658 GGCAACCCCAGCCCTGCAACTGG - Intronic
1133883327 16:9803664-9803686 AGTATGCCCATCCCTGCACAAGG - Intronic
1134893057 16:17858384-17858406 CACTAGCCCAGCCATGTACAGGG + Intergenic
1136479910 16:30534683-30534705 CGCATGCCCAGGCCTGGCCAGGG - Exonic
1139682220 16:68573920-68573942 CGAAAACTCAGCACTGCACATGG - Intronic
1139953617 16:70683401-70683423 CGCAAGCCCTGCCCTCTGCAGGG + Intronic
1140415414 16:74770743-74770765 CACTAGCCCAGCCCTCCACTGGG - Intronic
1141412921 16:83847813-83847835 CGCAAGCCCAGACATGCAGATGG - Intergenic
1141464865 16:84198685-84198707 GGAAAGCCCAGGCCTGCAGATGG - Intergenic
1142242052 16:88952017-88952039 CCCAAACCCACCTCTGCACAGGG - Intronic
1142787227 17:2233722-2233744 GGCAAGCACAGCACAGCACAGGG + Intronic
1143319606 17:6059604-6059626 AGCTAGCGCAGCCCTGGACAGGG - Intronic
1143900673 17:10172325-10172347 CGCATGTCCGGCCCTGCCCAAGG + Intronic
1144793643 17:17876618-17876640 CCTAAGCCCAGCCCTGCGCCAGG + Intronic
1146159493 17:30552350-30552372 CTTAAGTCCAGCCCAGCACAGGG - Intergenic
1146489815 17:33272556-33272578 CATGAGCCCTGCCCTGCACATGG + Intronic
1149489901 17:57077082-57077104 TGCAGGTCAAGCCCTGCACACGG + Intergenic
1149659179 17:58325487-58325509 TTCCAGCTCAGCCCTGCACAGGG - Intronic
1150737305 17:67751618-67751640 AGCAAGCCCAGGCCTGAGCAAGG + Intergenic
1151536401 17:74741266-74741288 AGAAAGCACAGCCCTGCACTGGG + Intronic
1151818674 17:76484908-76484930 CCCAAGTCCTGACCTGCACAAGG + Intronic
1152037715 17:77883597-77883619 CTCCAGGCCAGCCCTGGACAAGG - Intergenic
1152702267 17:81824991-81825013 CGTGTGCCCAGCCCTGCACCAGG - Exonic
1152763599 17:82122726-82122748 TTAAAGGCCAGCCCTGCACACGG + Intronic
1153525352 18:5989879-5989901 TGCCTGCCCAGCCCTGCACTTGG - Intronic
1153988704 18:10376242-10376264 AGCTAGCCAAGCCCTGCAAAGGG - Intergenic
1154505564 18:15037294-15037316 CTCCAGCCCAGCACAGCACAGGG - Intergenic
1157336054 18:46738368-46738390 CATATGCCCAGCCCTGCACCAGG - Intronic
1159782794 18:72678513-72678535 CGCAAGCTCAGCCCCGCATGAGG - Intergenic
1160507834 18:79437169-79437191 CGCAGGCCCCACCCTGCAGAGGG - Intronic
1160791402 19:925366-925388 CGCCCGCCCAGCTCTGCACCGGG + Intergenic
1160795312 19:942586-942608 CCCCAGCCCAGCCCTGACCAAGG - Intronic
1161317972 19:3627088-3627110 GGCAGGCCCCTCCCTGCACAAGG - Intergenic
1161378299 19:3951100-3951122 CCCAGGCCCAGCCCTGCCTAAGG - Intergenic
1164704891 19:30312929-30312951 AGCAGGCCCTGCCCTGCAAAGGG - Intronic
1165266035 19:34664424-34664446 AGCAGCCCCAGCCCTGCCCAGGG + Intronic
1165729519 19:38135732-38135754 CCCACGCCCACCCCTGCAAACGG - Intronic
1165863008 19:38918862-38918884 CCCAAGCTCAGCCCTGAAGAAGG + Intronic
1166538764 19:43592385-43592407 CGCATGCCCAGCCCAGCCCTGGG + Exonic
1167066352 19:47189046-47189068 CGCCTGCCCAGCCCAGCACCTGG + Intronic
1167853562 19:52220220-52220242 CACAAGCCAGGCCATGCACAAGG - Exonic
925619989 2:5782623-5782645 CACTAGCCTAGGCCTGCACAGGG - Intergenic
925742367 2:7017442-7017464 CACCATCCCAGCCCTGCACCAGG + Intronic
926135103 2:10330930-10330952 AGCAAGCCCACCCCTGCATTCGG + Intronic
931012257 2:57930108-57930130 CCCAAGCCCAGCACAGCACCAGG + Intronic
932494235 2:72138607-72138629 CTCAGGCCAAGCCCTGCAGAGGG + Intronic
937084463 2:119161516-119161538 CTCAAGACCAGCCCTCCACCAGG + Intergenic
937449962 2:121993824-121993846 CACATGCCAAGCCCTGTACAAGG + Intergenic
938504753 2:131867558-131867580 CTCCAGCCCAGCACAGCACAGGG - Intergenic
938729066 2:134131811-134131833 TGCAAGCCCAGTCCTGTAAAAGG - Intronic
939928273 2:148201084-148201106 GGCAAGCCCAGGCCTGAGCAAGG - Intronic
941917777 2:170823499-170823521 CGAAAGCCCAGCCCTGCCGCCGG + Intronic
946407023 2:219497227-219497249 CGCCAGCCCAGCTCTGGGCACGG + Intronic
948681478 2:239638026-239638048 TGCAAACTCAGCCCAGCACATGG + Intergenic
948792919 2:240388527-240388549 GGCCAGCCCAGCCCTGAGCAAGG + Intergenic
949035314 2:241813441-241813463 AGCACGCACAGCCCGGCACAGGG - Intronic
1170770718 20:19330197-19330219 CCTCAGCCCAGCCCTGCCCAGGG - Intronic
1171381481 20:24737403-24737425 CGGAATCCCAGCCCTGCATATGG - Intergenic
1172484293 20:35288978-35289000 CGAAAGCTCAGCGCTGCCCAGGG + Intronic
1172753897 20:37270104-37270126 CCCAAGCCCAGCCCTGCCCCAGG + Intergenic
1173551794 20:43937697-43937719 GGCCCTCCCAGCCCTGCACATGG - Intronic
1174171565 20:48620994-48621016 GGCAAGCCCAGCCCAGGAGAGGG + Intergenic
1176087974 20:63306695-63306717 GGGAAGCCCAGCCCTGCCTACGG - Intronic
1176179102 20:63741282-63741304 CGCGTGCCCAGGCCTGCACGTGG + Intronic
1176792296 21:13331824-13331846 CTCCAGCCCAGCACAGCACAGGG + Intergenic
1177991694 21:28042690-28042712 CTCCAGCCCAGCACAGCACAGGG + Intergenic
1179177846 21:39021705-39021727 CCCCAGCTCAGCCCTCCACAGGG - Intergenic
1179346582 21:40563985-40564007 AGCAAGGCCAGCCATGCAAAAGG + Intronic
1179928116 21:44549808-44549830 CGCCCACCCAGCCCAGCACACGG + Intronic
1179938056 21:44617400-44617422 CGCCCACCCAGCCCAGCACAGGG - Intronic
1181171411 22:21012250-21012272 CTCCTGCCCTGCCCTGCACATGG - Intronic
1182121055 22:27787163-27787185 CGCAAGCAAAGCCCGGCAAAAGG + Intronic
1182358785 22:29734836-29734858 CCCAGCCCCAGCCCTGCAAATGG + Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1184130272 22:42513272-42513294 CCCACCCCCATCCCTGCACAGGG + Intronic
1184140450 22:42575100-42575122 CCCACCCCCATCCCTGCACAGGG + Intergenic
1184750623 22:46484316-46484338 CACCAGCCCAGCCCAGCCCATGG + Intronic
1185029769 22:48436042-48436064 CCCAAGCCCAGACCTGCATTCGG - Intergenic
1185218157 22:49615408-49615430 CGCGAGACCAGTCCTGCACGTGG + Intronic
949535762 3:4995214-4995236 CCCAAACCCAGCCCAGGACAAGG - Intergenic
950102911 3:10369063-10369085 TGGGAGCCCAGCCCTGCCCAGGG + Intronic
950509917 3:13420008-13420030 CGAAGGCCCAGCCCGGCCCACGG + Intronic
951353164 3:21631087-21631109 CGCAAACCCAGGCCCACACAGGG - Intronic
954289366 3:49641442-49641464 CACGTGCCCATCCCTGCACAGGG + Intronic
954423381 3:50430571-50430593 TGCACCCCCAGCCCTGAACAGGG + Intronic
954974563 3:54680908-54680930 CCCAGGACCAGCCCTGCACTTGG - Intronic
961448284 3:126991300-126991322 TGCACTCCCAGCCCTGCCCAGGG + Intronic
962722434 3:138187961-138187983 TGCAAGCCCGGCGCTTCACAAGG - Intronic
962895392 3:139709378-139709400 CCTGAGCCCAGCCCTGCACTAGG - Intergenic
963110596 3:141684734-141684756 AGCAACCACAGCCTTGCACAAGG + Intergenic
965456704 3:168910344-168910366 AGAAAGCCCAGCCCAGCTCACGG - Intergenic
969051820 4:4378631-4378653 CCCAGGCCCAGCCCTGCTCTCGG - Intronic
969055188 4:4397277-4397299 CCCAAGCCCAGGCATGCACTGGG - Intronic
969220721 4:5756775-5756797 CCCCACCCCAGACCTGCACACGG - Intronic
969386423 4:6852577-6852599 TTTCAGCCCAGCCCTGCACATGG - Intronic
971357905 4:25911579-25911601 GGCCAGCCAAGCCCTGCTCACGG - Intronic
972253716 4:37332135-37332157 GCCAAGCCCAGCCCAGCACCAGG - Intronic
975481670 4:74887854-74887876 CGCAATCCCAGCACTTCAGAAGG + Intergenic
976068340 4:81215065-81215087 AGCCAGCCCCGCCGTGCACACGG + Exonic
980304906 4:131047116-131047138 CCCCAGCCCAGCAATGCACAGGG + Intergenic
980994205 4:139764922-139764944 CCCAGGCCCAGCCCTGCATTGGG - Intronic
983227841 4:165101645-165101667 CACAAGGCCACCCCTGCACATGG + Intronic
983544015 4:168943276-168943298 TGCAACCCCAGCCCTGTAGAAGG + Intronic
985557816 5:565949-565971 TGGGAGCCAAGCCCTGCACACGG - Intergenic
986138739 5:5009159-5009181 TGCATGTCCAGCCCTGTACAAGG + Intergenic
986733418 5:10651316-10651338 CCCATGCCCTGCCCTGCCCAAGG - Intergenic
991500605 5:67272852-67272874 CGCAAGCCCTGCCAGGCACAGGG - Intergenic
992391152 5:76331868-76331890 TGGAAATCCAGCCCTGCACAGGG - Intronic
992452056 5:76884198-76884220 CGAAAGCCCAGCCCAGTTCATGG - Intronic
993559411 5:89385606-89385628 CACAACCCCAGCGCTCCACACGG + Intergenic
995557470 5:113344390-113344412 CCTAAGCCCAGCCCAGCACTAGG - Intronic
997431524 5:133844311-133844333 CCCACTCCCAGGCCTGCACAGGG + Intergenic
1001144215 5:169169929-169169951 CGCAAGTCCAGCCCTCCCCTGGG + Intronic
1001791801 5:174464084-174464106 CGTCAGCCCTGCTCTGCACAGGG - Intergenic
1003038696 6:2667692-2667714 CGCAAACACATCCCTGCACCCGG - Exonic
1006640202 6:35485775-35485797 GGCAGGCCCAGCCCTTCCCAGGG - Intronic
1009978745 6:70701406-70701428 TGCAAGCCCAGCACAGCACCGGG + Intronic
1010372786 6:75130860-75130882 GGAAATCCCAGCCCTGCCCAGGG - Exonic
1011553579 6:88551296-88551318 CGGAAGCCCAAACTTGCACAGGG + Intergenic
1011850356 6:91620115-91620137 GGCCAGCCCAGCCCTGGCCATGG + Intergenic
1016876875 6:148874037-148874059 AGCAGCCCCAGCCCTGCACATGG - Intronic
1018755813 6:166849084-166849106 GGCAGCCCCAGGCCTGCACATGG + Intronic
1018857618 6:167685818-167685840 CTCAGGCTCTGCCCTGCACAGGG + Intergenic
1019363102 7:616090-616112 CCCAGGCCCAGCCCTGCCCGCGG + Intronic
1019648243 7:2142340-2142362 CCCCAACCCAGCCCTGCACCAGG - Intronic
1020653487 7:10903087-10903109 CTCAAGACCAGCCCTGGGCAAGG - Intergenic
1023170589 7:37386813-37386835 CCCAAGCCCTTCCCTGCACACGG + Intronic
1023284420 7:38604483-38604505 CACTGCCCCAGCCCTGCACAGGG + Intronic
1023601364 7:41884675-41884697 TGCAAGCCCAGCCCTTCCCTGGG + Intergenic
1024485236 7:49910180-49910202 TGGATGCCCAGCTCTGCACATGG - Intronic
1026592755 7:71711046-71711068 CACAAGCCCAGCCCGGGGCAGGG - Intronic
1026675701 7:72426200-72426222 CCCAGGCCCAGCCCAGCCCAAGG + Intronic
1026846296 7:73700705-73700727 CAGTAGCCCAGCCCTGCCCAAGG - Intronic
1029113467 7:98224779-98224801 CGTAAGCCTCTCCCTGCACAGGG - Exonic
1029318928 7:99740010-99740032 CATAAGCCCAGCCTTGCCCAAGG + Intergenic
1030662662 7:112238506-112238528 TCCAAGCCCAGCACAGCACAAGG - Intronic
1031682396 7:124690519-124690541 CGCAACCCCACCCCTGCCCCAGG - Intergenic
1032084130 7:128874693-128874715 CGCAAGCCCAGGCCAGCTCAGGG - Intronic
1035270045 7:157714380-157714402 CGCAAGCCCAGCCCTGCACAGGG - Intronic
1035284417 7:157797095-157797117 CGAAATCCCAGCCCTCAACACGG + Intronic
1035741522 8:1931440-1931462 CGAAAACACAGCCCTGCACGGGG - Intronic
1035763510 8:2086741-2086763 CTCAAGCTCAGTCCTCCACACGG - Intronic
1039508191 8:38067617-38067639 ACCAAGCGCAGCCATGCACATGG + Intergenic
1039977940 8:42383219-42383241 GGTAAGGCCAGCCCTCCACAAGG + Intergenic
1040724135 8:50361187-50361209 TGCTAGCCTAGGCCTGCACAGGG + Intronic
1040776063 8:51044574-51044596 CCCAAGCCCTGCCCTCCACTGGG - Intergenic
1045112733 8:98949264-98949286 CGTCCTCCCAGCCCTGCACAAGG + Exonic
1049127198 8:140802254-140802276 CGCTAGCCTAGGCCTACACAGGG - Intronic
1049142238 8:140965439-140965461 CACAAGCCATGCACTGCACAAGG + Intronic
1049282052 8:141754518-141754540 AGCAAGCCCAGCCCAGACCATGG + Intergenic
1049756802 8:144314369-144314391 CCCAAGACCAGCCCTGCACTGGG - Exonic
1052997759 9:34560050-34560072 CCCAAGCCCTTCCCTGCTCAGGG - Intronic
1056383547 9:86077227-86077249 CGCAAGCCCAGCCAGGGACTTGG + Intronic
1058481142 9:105396585-105396607 GTCAAGCCCAGCCCAGCATATGG + Exonic
1060482629 9:124026113-124026135 CTCCAGCCCTGCCCGGCACATGG - Intronic
1060729783 9:126030029-126030051 TCCTAGCTCAGCCCTGCACAGGG + Intergenic
1060732623 9:126048055-126048077 CCCCAGCCCCACCCTGCACAGGG - Intergenic
1061322427 9:129839616-129839638 CACACCCCCAGCCCCGCACAGGG - Intronic
1061859434 9:133460401-133460423 CGCCAGCCCAGCCCAGCCCGGGG - Intronic
1062030631 9:134360369-134360391 GGCAAGCCCAGGCCTGGGCACGG - Intronic
1062096048 9:134704169-134704191 TGCAAACCCAGCCCTGAACACGG - Intronic
1062189729 9:135241877-135241899 AGCAAGCCCAGGCCTGCAGGAGG + Intergenic
1187836151 X:23434502-23434524 TGCAAGCCCAGCACTGCAGCAGG - Intergenic
1189606819 X:42686998-42687020 GGCAAGTTCAGCCCTGCCCAGGG - Intergenic
1196093857 X:111777167-111777189 GGCCAGCCCAGCCCTGCCCATGG - Intronic
1197587321 X:128364379-128364401 TCCAAGCCCAGCGCAGCACAAGG + Intergenic
1200055359 X:153457216-153457238 CGCAGGCACAGCCCTGGGCAAGG + Exonic
1200075077 X:153546815-153546837 CCCAAACCCAGCTCCGCACAGGG - Intronic
1200114683 X:153764940-153764962 CCCCAGCCCAGCCCTGCCCCTGG - Intronic