ID: 1035270148

View in Genome Browser
Species Human (GRCh38)
Location 7:157714989-157715011
Sequence CCCCATGTGCTTTTCCTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035270136_1035270148 16 Left 1035270136 7:157714950-157714972 CCGCTTTCCGAGGCCAGCTCCCC 0: 1
1: 0
2: 1
3: 25
4: 230
Right 1035270148 7:157714989-157715011 CCCCATGTGCTTTTCCTGAATGG No data
1035270142_1035270148 -3 Left 1035270142 7:157714969-157714991 CCCCAGGGAACGGCGCCCAGCCC 0: 1
1: 1
2: 0
3: 29
4: 192
Right 1035270148 7:157714989-157715011 CCCCATGTGCTTTTCCTGAATGG No data
1035270143_1035270148 -4 Left 1035270143 7:157714970-157714992 CCCAGGGAACGGCGCCCAGCCCC 0: 1
1: 0
2: 1
3: 21
4: 184
Right 1035270148 7:157714989-157715011 CCCCATGTGCTTTTCCTGAATGG No data
1035270141_1035270148 3 Left 1035270141 7:157714963-157714985 CCAGCTCCCCAGGGAACGGCGCC 0: 2
1: 0
2: 1
3: 11
4: 245
Right 1035270148 7:157714989-157715011 CCCCATGTGCTTTTCCTGAATGG No data
1035270139_1035270148 9 Left 1035270139 7:157714957-157714979 CCGAGGCCAGCTCCCCAGGGAAC 0: 1
1: 0
2: 1
3: 43
4: 407
Right 1035270148 7:157714989-157715011 CCCCATGTGCTTTTCCTGAATGG No data
1035270135_1035270148 17 Left 1035270135 7:157714949-157714971 CCCGCTTTCCGAGGCCAGCTCCC 0: 1
1: 0
2: 0
3: 25
4: 204
Right 1035270148 7:157714989-157715011 CCCCATGTGCTTTTCCTGAATGG No data
1035270144_1035270148 -5 Left 1035270144 7:157714971-157714993 CCAGGGAACGGCGCCCAGCCCCA 0: 1
1: 0
2: 2
3: 29
4: 220
Right 1035270148 7:157714989-157715011 CCCCATGTGCTTTTCCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035270148 Original CRISPR CCCCATGTGCTTTTCCTGAA TGG Intronic
No off target data available for this crispr