ID: 1035270519

View in Genome Browser
Species Human (GRCh38)
Location 7:157717167-157717189
Sequence AAAGCCTCGTGGATCGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035270519_1035270522 13 Left 1035270519 7:157717167-157717189 CCAAAATCGATCCACGAGGCTTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1035270522 7:157717203-157717225 TCTAAAAAAAGCACATTTGGTGG No data
1035270519_1035270521 10 Left 1035270519 7:157717167-157717189 CCAAAATCGATCCACGAGGCTTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1035270521 7:157717200-157717222 ATCTCTAAAAAAAGCACATTTGG 0: 1
1: 0
2: 3
3: 41
4: 543
1035270519_1035270523 14 Left 1035270519 7:157717167-157717189 CCAAAATCGATCCACGAGGCTTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1035270523 7:157717204-157717226 CTAAAAAAAGCACATTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035270519 Original CRISPR AAAGCCTCGTGGATCGATTT TGG (reversed) Intronic
900284652 1:1893326-1893348 AAAGCCTGGAGGATGGAATTCGG - Intergenic
915633224 1:157168056-157168078 AGAGCCTCATGGATGGAATTAGG + Intergenic
917922714 1:179764392-179764414 AAAGTCTCGTGGATAGACTTTGG + Intronic
1085226770 11:74928560-74928582 AATGCCTCATGGATGGCTTTGGG + Intronic
1101539485 12:105652167-105652189 AAAGCCTAGTGAATCTCTTTGGG + Intergenic
1104274956 12:127318230-127318252 AAAGCCTCGGGGAAAGATTACGG - Intergenic
1105415021 13:20203830-20203852 AAAGCCTGGGGTATCTATTTAGG + Intergenic
1130693605 15:86107862-86107884 AAAGCCTGGTGCATCCATATGGG + Intergenic
1138595972 16:58029106-58029128 AAAGGCGGGTGGATCGGTTTTGG - Intronic
1148949501 17:51298117-51298139 AAAGCATGGAGGATCGATTCAGG - Intergenic
1167540545 19:50084503-50084525 CCAGCCTCGTGGATCACTTTAGG - Intergenic
1167629169 19:50613312-50613334 CCAGCCTCGTGGATCACTTTAGG + Intergenic
932894046 2:75621683-75621705 AAAGCCTTGTGGATTGGCTTGGG - Intergenic
934628455 2:95886758-95886780 ACATCCACGTTGATCGATTTAGG - Intronic
934805069 2:97214765-97214787 ACATCCACGTTGATCGATTTAGG + Intronic
934832413 2:97542621-97542643 ACATCCACGTTGATCGATTTAGG - Intronic
935599431 2:104907389-104907411 AAAGCCTTGTGTATCTACTTGGG + Intergenic
936869410 2:117116742-117116764 AAAGACTAGTGGATAGTTTTTGG + Intergenic
954611508 3:51946903-51946925 AAAGCCTCCTCGATCGTTCTGGG - Intronic
956013753 3:64859207-64859229 ACAGCCTCTTGGATCTATCTTGG - Intergenic
959226825 3:103597604-103597626 AATGCCTAGTGGACCTATTTGGG - Intergenic
959837214 3:110933568-110933590 AAAGCCTCCTGGATTGAATTTGG - Intergenic
965199031 3:165632730-165632752 CAAGCCCAGTGGATTGATTTGGG + Intergenic
983951896 4:173652466-173652488 AAGGCCTCGGGAATGGATTTTGG + Intergenic
990014343 5:51040793-51040815 AAAGCCTCTTTGATTCATTTTGG + Intergenic
990505454 5:56439794-56439816 AAAGCTCTGTGGATCGTTTTAGG - Intergenic
991634072 5:68685663-68685685 AAAGCCTCGTGCTGCCATTTTGG + Intergenic
1005258347 6:24029253-24029275 TAAGCCTCATGGTTCAATTTGGG - Intergenic
1006568511 6:34980644-34980666 GAAGCCTCCTGGATAAATTTAGG + Intronic
1017502099 6:155035035-155035057 AAAGCTTCGTGGACCCATATAGG - Intronic
1027575923 7:79930947-79930969 AAAGCCTCATGGAATGAGTTAGG + Intergenic
1035270519 7:157717167-157717189 AAAGCCTCGTGGATCGATTTTGG - Intronic
1036200247 8:6764990-6765012 ACTGGCTCGTGGATAGATTTTGG + Intergenic
1048548966 8:135415921-135415943 AAAGCCTTGTGGTTGGAGTTTGG + Intergenic
1055440509 9:76331870-76331892 AGAGCCCTGTGGATCTATTTTGG + Intronic
1056784431 9:89580092-89580114 ATAGTCACGTGGATAGATTTTGG - Intergenic